ID: 1008959663

View in Genome Browser
Species Human (GRCh38)
Location 6:57253513-57253535
Sequence CTCTGCACAACTACAGTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008959663_1008959671 25 Left 1008959663 6:57253513-57253535 CCTGGTACTGTAGTTGTGCAGAG No data
Right 1008959671 6:57253561-57253583 GATCATGGAGCTCGTTCTCTTGG No data
1008959663_1008959668 10 Left 1008959663 6:57253513-57253535 CCTGGTACTGTAGTTGTGCAGAG No data
Right 1008959668 6:57253546-57253568 ACCCTTCAGCACTGAGATCATGG No data
1008959663_1008959672 28 Left 1008959663 6:57253513-57253535 CCTGGTACTGTAGTTGTGCAGAG No data
Right 1008959672 6:57253564-57253586 CATGGAGCTCGTTCTCTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008959663 Original CRISPR CTCTGCACAACTACAGTACC AGG (reversed) Intergenic
No off target data available for this crispr