ID: 1008959667

View in Genome Browser
Species Human (GRCh38)
Location 6:57253544-57253566
Sequence ATGATCTCAGTGCTGAAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008959667_1008959673 16 Left 1008959667 6:57253544-57253566 CCACCCTTCAGCACTGAGATCAT No data
Right 1008959673 6:57253583-57253605 GTGGTTTTCATGATTGAACCTGG No data
1008959667_1008959671 -6 Left 1008959667 6:57253544-57253566 CCACCCTTCAGCACTGAGATCAT No data
Right 1008959671 6:57253561-57253583 GATCATGGAGCTCGTTCTCTTGG No data
1008959667_1008959672 -3 Left 1008959667 6:57253544-57253566 CCACCCTTCAGCACTGAGATCAT No data
Right 1008959672 6:57253564-57253586 CATGGAGCTCGTTCTCTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008959667 Original CRISPR ATGATCTCAGTGCTGAAGGG TGG (reversed) Intergenic
No off target data available for this crispr