ID: 1008959672

View in Genome Browser
Species Human (GRCh38)
Location 6:57253564-57253586
Sequence CATGGAGCTCGTTCTCTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008959669_1008959672 -6 Left 1008959669 6:57253547-57253569 CCCTTCAGCACTGAGATCATGGA No data
Right 1008959672 6:57253564-57253586 CATGGAGCTCGTTCTCTTGGTGG No data
1008959666_1008959672 -2 Left 1008959666 6:57253543-57253565 CCCACCCTTCAGCACTGAGATCA No data
Right 1008959672 6:57253564-57253586 CATGGAGCTCGTTCTCTTGGTGG No data
1008959667_1008959672 -3 Left 1008959667 6:57253544-57253566 CCACCCTTCAGCACTGAGATCAT No data
Right 1008959672 6:57253564-57253586 CATGGAGCTCGTTCTCTTGGTGG No data
1008959663_1008959672 28 Left 1008959663 6:57253513-57253535 CCTGGTACTGTAGTTGTGCAGAG No data
Right 1008959672 6:57253564-57253586 CATGGAGCTCGTTCTCTTGGTGG No data
1008959670_1008959672 -7 Left 1008959670 6:57253548-57253570 CCTTCAGCACTGAGATCATGGAG No data
Right 1008959672 6:57253564-57253586 CATGGAGCTCGTTCTCTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008959672 Original CRISPR CATGGAGCTCGTTCTCTTGG TGG Intergenic
No off target data available for this crispr