ID: 1008966987

View in Genome Browser
Species Human (GRCh38)
Location 6:57322629-57322651
Sequence GACTCACAGTTCCCCAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22190
Summary {0: 5, 1: 251, 2: 3897, 3: 9101, 4: 8936}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008966987_1008966994 17 Left 1008966987 6:57322629-57322651 CCAGCCCTGGGGAACTGTGAGTC 0: 5
1: 251
2: 3897
3: 9101
4: 8936
Right 1008966994 6:57322669-57322691 TTTATGGGTTTACTCAGTCTTGG 0: 1
1: 0
2: 2
3: 14
4: 150
1008966987_1008966991 2 Left 1008966987 6:57322629-57322651 CCAGCCCTGGGGAACTGTGAGTC 0: 5
1: 251
2: 3897
3: 9101
4: 8936
Right 1008966991 6:57322654-57322676 TTAAACCTCTTTCCTTTTATGGG 0: 1
1: 0
2: 2
3: 28
4: 377
1008966987_1008966990 1 Left 1008966987 6:57322629-57322651 CCAGCCCTGGGGAACTGTGAGTC 0: 5
1: 251
2: 3897
3: 9101
4: 8936
Right 1008966990 6:57322653-57322675 GTTAAACCTCTTTCCTTTTATGG 0: 1
1: 0
2: 0
3: 31
4: 267
1008966987_1008966995 18 Left 1008966987 6:57322629-57322651 CCAGCCCTGGGGAACTGTGAGTC 0: 5
1: 251
2: 3897
3: 9101
4: 8936
Right 1008966995 6:57322670-57322692 TTATGGGTTTACTCAGTCTTGGG 0: 1
1: 0
2: 0
3: 13
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008966987 Original CRISPR GACTCACAGTTCCCCAGGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr