ID: 1008966990

View in Genome Browser
Species Human (GRCh38)
Location 6:57322653-57322675
Sequence GTTAAACCTCTTTCCTTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 267}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008966982_1008966990 13 Left 1008966982 6:57322617-57322639 CCTGAGGTCTCCCCAGCCCTGGG 0: 1
1: 18
2: 343
3: 2098
4: 5643
Right 1008966990 6:57322653-57322675 GTTAAACCTCTTTCCTTTTATGG 0: 1
1: 0
2: 0
3: 31
4: 267
1008966987_1008966990 1 Left 1008966987 6:57322629-57322651 CCAGCCCTGGGGAACTGTGAGTC 0: 5
1: 251
2: 3897
3: 9101
4: 8936
Right 1008966990 6:57322653-57322675 GTTAAACCTCTTTCCTTTTATGG 0: 1
1: 0
2: 0
3: 31
4: 267
1008966988_1008966990 -3 Left 1008966988 6:57322633-57322655 CCCTGGGGAACTGTGAGTCAGTT 0: 5
1: 252
2: 2812
3: 7427
4: 7818
Right 1008966990 6:57322653-57322675 GTTAAACCTCTTTCCTTTTATGG 0: 1
1: 0
2: 0
3: 31
4: 267
1008966985_1008966990 3 Left 1008966985 6:57322627-57322649 CCCCAGCCCTGGGGAACTGTGAG 0: 7
1: 261
2: 4036
3: 9123
4: 9341
Right 1008966990 6:57322653-57322675 GTTAAACCTCTTTCCTTTTATGG 0: 1
1: 0
2: 0
3: 31
4: 267
1008966979_1008966990 29 Left 1008966979 6:57322601-57322623 CCATGATTGTAAGTTTCCTGAGG 0: 5695
1: 8136
2: 6569
3: 4228
4: 2890
Right 1008966990 6:57322653-57322675 GTTAAACCTCTTTCCTTTTATGG 0: 1
1: 0
2: 0
3: 31
4: 267
1008966989_1008966990 -4 Left 1008966989 6:57322634-57322656 CCTGGGGAACTGTGAGTCAGTTA 0: 3
1: 71
2: 878
3: 2088
4: 2955
Right 1008966990 6:57322653-57322675 GTTAAACCTCTTTCCTTTTATGG 0: 1
1: 0
2: 0
3: 31
4: 267
1008966986_1008966990 2 Left 1008966986 6:57322628-57322650 CCCAGCCCTGGGGAACTGTGAGT 0: 7
1: 282
2: 4254
3: 9482
4: 9076
Right 1008966990 6:57322653-57322675 GTTAAACCTCTTTCCTTTTATGG 0: 1
1: 0
2: 0
3: 31
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008966990 Original CRISPR GTTAAACCTCTTTCCTTTTA TGG Intronic
901708070 1:11091619-11091641 GTTAAGCATTTTTCCTTTTGAGG + Intronic
902948914 1:19865571-19865593 GTTAAACCTCTGAAATTTTAGGG - Intergenic
902992479 1:20198325-20198347 ATTAAACTACTTTCCCTTTATGG + Intergenic
903198797 1:21715627-21715649 GATGTTCCTCTTTCCTTTTAAGG - Intronic
905444317 1:38015482-38015504 TCTAAACCTCATTCCCTTTATGG + Intronic
907914745 1:58858409-58858431 GTTACACCTCTGTGCTTTGACGG + Intergenic
908221446 1:62010705-62010727 ATTAAACTCCTTTCCTTATATGG - Intronic
908514414 1:64877580-64877602 GTTAACTCTCTTCCCTTTTCTGG + Intronic
909258395 1:73454175-73454197 GTTAAATCTCTTTCAGTTAATGG - Intergenic
909833059 1:80218144-80218166 TTTAAATCTCTTGCCTTTAAAGG + Intergenic
910526390 1:88183743-88183765 TTTATTCCTCTTTCTTTTTAAGG + Intergenic
910603922 1:89062321-89062343 GTCAAAACTCTTCCTTTTTAAGG - Intronic
910636219 1:89411202-89411224 GTCAAAACTCTTCCTTTTTAAGG + Intergenic
911166333 1:94727847-94727869 TTTAAACCTCTTTTCCTATACGG - Intergenic
911660052 1:100491174-100491196 TTTAAATCTCTGTCGTTTTATGG - Intronic
911680560 1:100710672-100710694 GGTAAAACTCTTTACTTTTAGGG - Intergenic
912354019 1:109041190-109041212 GTTAAACCGCTTCCCTTTATTGG - Intronic
913084951 1:115428191-115428213 GTTCAACTTCTTTCCTTTCCTGG - Intergenic
915449706 1:155996127-155996149 GTTAAACCTCATCTCTTTGAGGG - Intronic
916116286 1:161487624-161487646 TTTAAACCAGTTTCCTTTCATGG - Intergenic
918244266 1:182645157-182645179 GCTGAACCATTTTCCTTTTAAGG - Intergenic
919084238 1:192902257-192902279 TTTAAACCTCTTTCCTACTCTGG - Intergenic
919450966 1:197772931-197772953 ATTTAAACTTTTTCCTTTTAGGG - Exonic
919569312 1:199226301-199226323 TTTAAACATCTTTACTTTTTGGG - Intergenic
922365629 1:224860895-224860917 GTTAAAACTCTTTTCTTTCGTGG - Intergenic
923130853 1:231073432-231073454 ATTATACCTCCTCCCTTTTAGGG + Intergenic
1063031333 10:2238231-2238253 ATTAAACCTCTTTTCTTTAAAGG - Intergenic
1064512208 10:16107814-16107836 CTGAAACCTCTTTCCATATAGGG + Intergenic
1064698115 10:17988520-17988542 ATTAAACCTCTTTTCTTTATAGG + Intronic
1065021309 10:21503718-21503740 CTTAAACCTCTTTCCCTGAAAGG + Intergenic
1066225902 10:33383079-33383101 TTTTAGCCTCTTTCTTTTTATGG - Intergenic
1068245772 10:54365056-54365078 GAGAAAATTCTTTCCTTTTAAGG + Intronic
1071150180 10:82625013-82625035 GTTAAAGATCTTTCCTATTCTGG + Intronic
1071190746 10:83096518-83096540 GTTGAACTTGTTTCCTATTATGG - Intergenic
1071984281 10:91035155-91035177 ATTAAAACTCTATCCTTTTAGGG - Intergenic
1073740795 10:106404123-106404145 TTTCAACCTTTTTCTTTTTAGGG - Intergenic
1075363382 10:121860499-121860521 GGTAAACCTTTTTGCTTTCATGG - Intronic
1075945092 10:126425863-126425885 GTTAGACCGCATTCCTTTGAAGG + Exonic
1076182470 10:128421154-128421176 TTTAAGCCTCTGTCCTTTAAGGG + Intergenic
1078250906 11:9615460-9615482 GTTAAAACGTGTTCCTTTTATGG + Intergenic
1078457792 11:11488861-11488883 GTTAAAGCTCTTGGCTTTTCAGG - Intronic
1078820992 11:14881851-14881873 ATTAAACCTCTTTTCTTTATAGG + Intronic
1080098518 11:28432309-28432331 GGTATATCTCTTTCTTTTTAAGG + Intergenic
1080500168 11:32863105-32863127 ATTATACCCTTTTCCTTTTATGG - Intergenic
1081012444 11:37832233-37832255 GTTAATGAGCTTTCCTTTTAAGG + Intergenic
1081132974 11:39403051-39403073 GGGAAACCTGGTTCCTTTTATGG - Intergenic
1081879867 11:46439620-46439642 ATTATACAACTTTCCTTTTATGG - Intronic
1084352074 11:68609427-68609449 GTTAAAGCACTTTGCTTTTGGGG - Intronic
1084740829 11:71138450-71138472 GTGAAACCTCCTTACTTTTGGGG + Intronic
1085090791 11:73711491-73711513 GTCAAACCATTTTCCTTTTGTGG + Intronic
1085268611 11:75254844-75254866 GGTAAACCTATTTGTTTTTAAGG - Intergenic
1085890701 11:80575000-80575022 GTAAAACTTGTTTCCTTTTAAGG + Intergenic
1087409289 11:97770520-97770542 GTTACACATCCTTCCTTTTTTGG + Intergenic
1087694469 11:101360822-101360844 GTTAAAACTAATTCCTTTTATGG + Intergenic
1087821545 11:102718214-102718236 CTTAAACTTTTTTTCTTTTAGGG + Intronic
1087971833 11:104493708-104493730 GGTAAATTTCTTTCCTTTTGAGG - Intergenic
1087976788 11:104559399-104559421 GTTAAACCTCTGTCTTTTAGTGG - Intergenic
1089996516 11:122913026-122913048 GTTATATCTCTTTCATTTTGAGG - Intronic
1090461990 11:126899399-126899421 GTGACACTTCTTTTCTTTTACGG - Intronic
1091420238 12:332481-332503 GTTAAACTACTTTCTCTTTAAGG + Intronic
1091501894 12:1026089-1026111 ATTAAACCTCTTTCCTGGCAGGG - Intronic
1091922639 12:4317981-4318003 GTAAAACCTCTTTCACTTTAAGG - Intergenic
1092304067 12:7281629-7281651 GATAATCCTCATTCCTTTCAAGG + Intergenic
1092842731 12:12558815-12558837 CTTATTCCTCTTTCCTTTCATGG + Intronic
1093313433 12:17619441-17619463 GTTACACCTCCTACCTTTTATGG + Intergenic
1093873780 12:24325167-24325189 GTTAATGCTCTTTCTTTTTTAGG - Intergenic
1095574109 12:43715006-43715028 GTACAAGCTCTTTCCTTTTTTGG + Intergenic
1096625014 12:52889491-52889513 TTTTAAACTCTTTCCTTTTGGGG - Intergenic
1098411288 12:70186483-70186505 CTTTGACCTCTTGCCTTTTAAGG + Intergenic
1099006330 12:77238651-77238673 GTTAAAACACTTTCTTTATATGG + Intergenic
1099117074 12:78640995-78641017 CTTAAACTTTTTTCCTTTCAAGG - Intergenic
1099213269 12:79820355-79820377 GTAAAAACTCTTTCCTGTGAGGG - Intronic
1099213328 12:79821305-79821327 ATTCAAGCTCTTTCCTTTTCAGG - Intronic
1099497398 12:83366895-83366917 CTCAGATCTCTTTCCTTTTAGGG - Intergenic
1100006866 12:89905050-89905072 TTTAAATTTCTTTCCTTATATGG - Intergenic
1100423139 12:94457300-94457322 GTTTAACCTATGTGCTTTTAGGG - Intronic
1101006224 12:100403605-100403627 GATAAACCTCTTTCCTACAAGGG + Intronic
1102783996 12:115588985-115589007 GTTAAACATTTTTCCTGTTTTGG - Intergenic
1106733462 13:32566296-32566318 GTTAAACCTTTTTTCTTTATGGG - Intergenic
1107790497 13:43997403-43997425 GATAATTCTCTGTCCTTTTATGG - Intergenic
1110869516 13:80434038-80434060 GTTAATCCTCTTTCCATTAAAGG + Intergenic
1111388178 13:87556946-87556968 ATTAAACCTCTTTTCTTTATAGG + Intergenic
1111713109 13:91842912-91842934 GTTAAACTATTTTCATTTTAGGG - Intronic
1112399195 13:99061065-99061087 GTTTAATCCCTTGCCTTTTAAGG + Intronic
1112767173 13:102757625-102757647 CCTAAACCTCTGTCCTTTTCGGG + Intronic
1113248320 13:108423519-108423541 GTTTAATCTCTTTCCTTTAAGGG + Intergenic
1114931881 14:27481181-27481203 TTTAAACCTATTTTTTTTTAAGG - Intergenic
1116944568 14:50824335-50824357 ATCAAACCTCTTTCATTTTATGG + Intronic
1117072713 14:52070147-52070169 TTTAAATATCTTTGCTTTTAAGG - Intergenic
1117483928 14:56174774-56174796 GTTAAACCTCTTTTCTTCACAGG + Intronic
1118824361 14:69367048-69367070 CTTATACCTTCTTCCTTTTAGGG - Intergenic
1119124849 14:72116238-72116260 GCTAAACCTCTTTTCTTCTGGGG - Intronic
1121093142 14:91196958-91196980 GTCAAACTTTTTTTCTTTTAGGG + Intronic
1122089577 14:99329305-99329327 ATTAAACCTCTTTCCTTGGCCGG + Intergenic
1124054294 15:26227513-26227535 GTTACTCTTCTGTCCTTTTATGG - Intergenic
1124510311 15:30318793-30318815 GTTATGCCCCTTCCCTTTTACGG - Intergenic
1124732578 15:32211760-32211782 GTTATGCCCCTTCCCTTTTATGG + Intergenic
1125539794 15:40463717-40463739 GTCAAACCACTATCCTTTTTTGG - Intronic
1128444450 15:67745049-67745071 GATGAACCTCTTCCCTTTTCTGG - Intronic
1128701362 15:69806965-69806987 TTTAATTCTCTTTCCTTCTAAGG - Intergenic
1130197357 15:81793106-81793128 GTTCTGCTTCTTTCCTTTTAAGG - Intergenic
1131921328 15:97331965-97331987 ATTAAACCTCTTTTCTTTATAGG + Intergenic
1132416166 15:101620498-101620520 GTTAACCCTGTGTCCTTTTCAGG - Intergenic
1135895654 16:26399612-26399634 GTTGAATCTCTTTCATTATATGG + Intergenic
1138068670 16:53968713-53968735 GTGAAATGTCTCTCCTTTTATGG - Intronic
1140828877 16:78733018-78733040 TTTACCCCTCTTTGCTTTTACGG + Intronic
1143671976 17:8403159-8403181 GTAAAATTTCCTTCCTTTTAAGG - Intergenic
1146156139 17:30525396-30525418 GGAAAACTTCTTTTCTTTTAAGG - Exonic
1146305102 17:31724607-31724629 GTTGCCCCTCTTTCCTTTTGCGG + Intergenic
1150142801 17:62744233-62744255 TTTAAAGCTGTTTCATTTTAAGG + Intronic
1150554333 17:66240167-66240189 GTTAAACCTCATTCCCTTTTAGG - Intronic
1154480802 18:14822163-14822185 ATTCAACCTCTTTCCTTATATGG + Intronic
1155330393 18:24709951-24709973 GTGAAAACTTTCTCCTTTTATGG + Intergenic
1155771637 18:29708456-29708478 CTTAAAATTCTTTCCTTTAATGG + Intergenic
1155998555 18:32358608-32358630 GTTAATTCTGTGTCCTTTTAAGG - Intronic
1156125874 18:33904468-33904490 GTTATCCCTCCTCCCTTTTATGG + Intronic
1156716150 18:40013350-40013372 GTTACAATTCTTTACTTTTAAGG - Intergenic
1157144947 18:45152701-45152723 GTTATCTCTGTTTCCTTTTATGG + Intergenic
1157950880 18:52035556-52035578 TTTTAATCTCTTTCTTTTTAGGG - Intergenic
1158183176 18:54741276-54741298 GATAAACCTCTTTAGCTTTAAGG - Intronic
1159174242 18:64813582-64813604 TTTAAACCTGCTTCCTTTCATGG + Intergenic
1159776494 18:72608786-72608808 ATTAAACCTCTTTCCTTTATAGG - Intronic
1160724581 19:612205-612227 GTTACACCACGTTCCCTTTAGGG - Intronic
1164693922 19:30229369-30229391 GTGAAACCACTTTCCTTATCAGG - Intronic
925027224 2:619803-619825 GTTAAACATCCTACCTTTTCTGG + Intergenic
925511680 2:4634045-4634067 ATTAAACCTCTTTTCTTTATAGG - Intergenic
925559558 2:5175296-5175318 GTTAAAAGTCTTTTCATTTATGG - Intergenic
926059026 2:9793724-9793746 ATTAAACCTCTTTCCTTGACTGG + Intergenic
926450959 2:13003212-13003234 GTGAGACCTCATTTCTTTTATGG + Intergenic
926967702 2:18433309-18433331 TTTAAATCTCTTTCCTTGTTTGG + Intergenic
929679954 2:43983105-43983127 GTTAAACATCATTAATTTTAAGG + Intronic
930904108 2:56545581-56545603 TTTGAACATCTTTCCTATTATGG + Intergenic
931119537 2:59200383-59200405 ATTAAACCTCTTTCCTTAATAGG + Intergenic
931457395 2:62422900-62422922 ACTAAACCTCATTCTTTTTATGG - Intergenic
932896045 2:75641005-75641027 GCTAAGGCTCTTTCCTTTTCTGG - Intergenic
933094116 2:78156791-78156813 GAGAGACCTCTTTTCTTTTAAGG + Intergenic
933431369 2:82183993-82184015 GAGAAACCTCTCTACTTTTAAGG + Intergenic
935097893 2:99963785-99963807 GTTAAGACTATTTACTTTTAAGG - Intronic
935424649 2:102907251-102907273 GACACAGCTCTTTCCTTTTAAGG - Intergenic
936677190 2:114729005-114729027 GTTAAACCTCCCTCCCATTATGG - Intronic
937023062 2:118676177-118676199 GTTAATTCTCTTTCCTCTGAAGG - Intergenic
937282631 2:120730833-120730855 GCAAAACCTCTTTCCTCTTCAGG - Intergenic
938881039 2:135588753-135588775 TTTAAAATTTTTTCCTTTTAAGG + Intronic
940416898 2:153433732-153433754 GTTAAAACTCTTCTCTTTTGAGG - Intergenic
941678368 2:168368412-168368434 GTTAAACCTATTACCATTCATGG - Intergenic
942203083 2:173592050-173592072 GTTAAACTTCTTTTCTTTTCTGG - Intergenic
943581526 2:189689241-189689263 ATTATACCCCTTTCCTTTTGTGG - Intronic
944764884 2:202854049-202854071 ATTGAACCTCTTTACATTTAAGG - Intronic
944975747 2:205048848-205048870 TTTAAAACTCTATCCTTCTAAGG + Intronic
945513908 2:210738122-210738144 GATAAACCTATTTCCTTGTTTGG - Intergenic
946736830 2:222762159-222762181 GCTATAACCCTTTCCTTTTAGGG + Intergenic
947196396 2:227572407-227572429 TTTAAATCTTTTTCCTTTCATGG - Intergenic
1169345453 20:4824638-4824660 GTTAAGCTTCTTTCCTTTGCAGG + Intergenic
1172828595 20:37812337-37812359 TATAAACCTCTTGCCTTTTGTGG + Intronic
1173381031 20:42541771-42541793 GTTATCCATCTTTCCTTTTATGG - Intronic
1173392706 20:42649113-42649135 ATTAAACCTCTTTCCTTGGCCGG - Intronic
1176890557 21:14312922-14312944 TTTTAACCTCTTTCTTTTTTAGG + Intergenic
1177658438 21:24050259-24050281 TTTAAACTTCTTTTATTTTAGGG - Intergenic
1178098670 21:29242402-29242424 GTTAATCCTCTTTCCATGTATGG + Intronic
1178154323 21:29833436-29833458 GTTAAACCTCTTTTCTTTATAGG - Intronic
1182140657 22:27954642-27954664 GTTAAATATCTTTTCTTGTATGG + Intergenic
1182562750 22:31174030-31174052 GTTAATCCCCCTCCCTTTTAAGG - Intronic
1182899234 22:33884329-33884351 GTTGACCCTCTTTCCTCTGATGG + Intronic
1184239140 22:43202721-43202743 ATTCAACCTCTTTCCTTTATAGG + Exonic
1184950116 22:47835291-47835313 GTTAAACATTTTTTCTTTCATGG - Intergenic
949346602 3:3082744-3082766 GTCAAGCCACTTCCCTTTTAGGG + Intronic
950279085 3:11690607-11690629 CTTAAACGTCTTTTCTTTTGTGG - Intronic
953645901 3:44754525-44754547 GTTAAACCTGTTCCCTTGTGTGG - Intronic
955721513 3:61886281-61886303 GTTAAAACTGTTACTTTTTATGG + Intronic
956740491 3:72271953-72271975 GTTAAACTTCTTTTCTTCTGTGG - Intergenic
958017001 3:87949901-87949923 AATAAACCTCTTTCCTTTATAGG - Intergenic
958174254 3:89974974-89974996 TTTAGACCTCTTTCCTATTTTGG - Intergenic
958871373 3:99562786-99562808 GAAACACCTCTTTGCTTTTAGGG + Intergenic
962846414 3:139278121-139278143 GTTAAAGCTCTTTCCTTGCAAGG - Intronic
963736345 3:149021468-149021490 TGTAAAGCTCTTTCCTCTTAAGG - Intronic
964838232 3:160964567-160964589 GTTAAACCTCTGTTGTTTAAGGG + Intronic
965275807 3:166680378-166680400 GCTTAACCTCTTTCCATTTCAGG + Intergenic
965394369 3:168143882-168143904 ATTAAGCCTCTTTCCTTTTTTGG - Intergenic
965437744 3:168673201-168673223 ATAAAACCTCTTTCCTTACATGG - Intergenic
965775652 3:172227725-172227747 GGTAAATATTTTTCCTTTTATGG - Intronic
965948647 3:174275771-174275793 GTTACTCTTCTTTCCTTTAAAGG + Intronic
967907527 3:194514046-194514068 CAAAAACCTCTTTCCTTTTCTGG - Intergenic
969102524 4:4779969-4779991 GGTAAACCCCTTTCCTTTTCTGG - Intergenic
971402661 4:26290664-26290686 GTTAAACTTGATTTCTTTTATGG - Intronic
972105053 4:35474042-35474064 GCTAAACCTCTTTAATTTTAAGG - Intergenic
973302675 4:48605833-48605855 TATATACCTCTTTCCCTTTAAGG - Exonic
974265545 4:59582242-59582264 ATTTAACCTGTTTACTTTTAAGG + Intergenic
975264471 4:72345772-72345794 GGGAAACTTCTTACCTTTTAAGG + Intronic
976649389 4:87418852-87418874 ATTAAACCTCTTTTCTATTGGGG - Intergenic
976994107 4:91408235-91408257 TGAAAACCTCTTACCTTTTATGG + Intronic
978506250 4:109460634-109460656 GTTAAACATCTTGACTTTTGTGG + Intronic
978884902 4:113757106-113757128 GTTTAGTCTCTTTCCTTTTCTGG - Intronic
978891080 4:113828385-113828407 GTAAAACCACTGTCCTTTGAAGG - Intergenic
980272979 4:130611104-130611126 CTTTAACCACTTACCTTTTATGG - Intergenic
981433213 4:144686913-144686935 GCTAAGCGTCTTTCTTTTTAAGG - Intronic
981837330 4:149069837-149069859 ATGAAATCTCTTTCCTTTTTAGG - Intergenic
982594385 4:157360387-157360409 GTTAAAACACATTCATTTTAAGG + Intronic
986427435 5:7648377-7648399 GTGAAACTTCTTTGCATTTACGG + Intronic
986982969 5:13470177-13470199 GTTATGCCTCTTTCCCCTTAAGG + Intergenic
986991977 5:13564789-13564811 ATTAAACCTCTTTCCTTTATAGG + Intergenic
987345634 5:16976370-16976392 GCTGTACCTCTTTCCTTTTTTGG - Intergenic
987633329 5:20505782-20505804 GCTAAACTTCTTTACTTTCATGG - Intronic
988080891 5:26413975-26413997 GTTAAAAATATTTCCATTTAAGG + Intergenic
988441738 5:31241524-31241546 GTTAAAGCACTTTCATTTTCAGG - Intronic
989220851 5:38960984-38961006 ATTAAACCTCTTTCCTTTATAGG + Intronic
990299154 5:54433465-54433487 GTTAAACCTATATACTTTTTTGG + Intergenic
990303717 5:54474488-54474510 GTTAGAATTCTTTACTTTTAAGG + Intergenic
990351391 5:54920123-54920145 GTTTAACCTGTTTACATTTAAGG - Intergenic
992159861 5:73990779-73990801 GTTAAATGTCTTTCCTTTAAGGG - Intergenic
992331611 5:75722718-75722740 TTGAAACCTGTTTCTTTTTAAGG + Intergenic
992457564 5:76929879-76929901 ATTGAGCCTCTTTCCTTTTGTGG - Intergenic
992486867 5:77205594-77205616 GGTAACTCTATTTCCTTTTATGG - Intergenic
993452581 5:88090979-88091001 ATTAAACATTTTTCCTCTTATGG + Intergenic
993650926 5:90521171-90521193 GTTTAACCTCTTTGCCATTAAGG + Intronic
994835038 5:104840236-104840258 CTTAAATGTTTTTCCTTTTAGGG - Intergenic
999541807 5:152582668-152582690 GTTTAACCTGTTTACTTTCAAGG + Intergenic
999566764 5:152872371-152872393 TATATACCTCTTTCCTTTTAGGG + Intergenic
1000542961 5:162563709-162563731 TTTATACCTGTTTCATTTTAGGG - Intergenic
1005262663 6:24078589-24078611 CTTAAAGTTCTTTCCGTTTATGG - Intergenic
1006063374 6:31442320-31442342 ATTAAACCTTTTTCTTTATAAGG + Intergenic
1007039320 6:38707133-38707155 GTTTAACTTTTTACCTTTTAGGG - Intergenic
1007050237 6:38820532-38820554 TTTAAACATCTTTTCTTCTATGG - Intronic
1007456581 6:41982366-41982388 TTTAAACTTATTTCATTTTAGGG - Intronic
1008257885 6:49326622-49326644 GTGAAACCTTTCTCCTTTTAAGG - Intergenic
1008966990 6:57322653-57322675 GTTAAACCTCTTTCCTTTTATGG + Intronic
1010392520 6:75353957-75353979 CCTAAACTTCTTTCCTTTTTTGG + Intronic
1010429199 6:75759286-75759308 GTAAAATCTCCTTCCTTTTGGGG - Intronic
1010498465 6:76566019-76566041 ATTAAACCCCTTTTCTTGTAAGG - Intergenic
1011497420 6:87950307-87950329 GTTCAAACTCTTTGCTTATATGG + Intergenic
1011513504 6:88127191-88127213 ATTACACCTCTTTCCCTTAATGG + Intergenic
1015489451 6:133809147-133809169 GATTTGCCTCTTTCCTTTTAAGG + Intergenic
1016050272 6:139523361-139523383 ATTAAAACTCTTTCCCTTTAGGG + Intergenic
1018140925 6:160836154-160836176 ATTAAACCTGTTTCCTTTACAGG - Intergenic
1020477428 7:8614246-8614268 GTTAAAACTGTTTTCTTATACGG + Intronic
1021006997 7:15409478-15409500 ATCAAACCCCATTCCTTTTAAGG - Intronic
1021344940 7:19515393-19515415 TTTAAAGTTTTTTCCTTTTAAGG + Intergenic
1023425207 7:40028701-40028723 TTTAAATCTCTTGTCTTTTAGGG + Intronic
1024140825 7:46461623-46461645 AGTACATCTCTTTCCTTTTATGG - Intergenic
1026038818 7:66848682-66848704 CTTACACGTCTTTCCTTGTAAGG + Intergenic
1027504063 7:78993414-78993436 TTTAAACATGTTTCTTTTTATGG - Intronic
1027821196 7:83047068-83047090 GTTTGACCTGTTTCCTTTTTTGG - Intronic
1028296320 7:89137060-89137082 ATTAAACCTCTTTCTTTCTCAGG + Intronic
1028454452 7:91023728-91023750 AAAAAACCACTTTCCTTTTATGG - Intronic
1028898614 7:96070288-96070310 GTTTAAGCACTTTCTTTTTATGG + Intronic
1030866349 7:114705477-114705499 ATTAAACCTCTTTCCTTCTTGGG + Intergenic
1031346079 7:120669028-120669050 GATAAAGTTATTTCCTTTTAGGG + Intronic
1031406373 7:121392259-121392281 GTTAAACTTCTTTCCTTTATAGG - Intronic
1032059125 7:128709030-128709052 GTTCACACTCATTCCTTTTAAGG - Intergenic
1033360813 7:140637821-140637843 GATAAGCCTCCTTCCCTTTATGG + Intronic
1034416850 7:150969839-150969861 GATAAACCCCTCTCCTTTTTGGG - Intronic
1036383596 8:8258210-8258232 GTTCTATCTCTTTCCTTTTCTGG + Intergenic
1036559137 8:9886758-9886780 GTCATGCCTCTTACCTTTTAGGG - Intergenic
1036994795 8:13643200-13643222 GTTAAACCTCCTTTCTTTATAGG + Intergenic
1037080718 8:14782256-14782278 GTAAAAACTCTGTCATTTTAAGG + Intronic
1039507004 8:38059453-38059475 GTTAAACCTCTTTTCTTGGCTGG + Intronic
1040415685 8:47192773-47192795 TTTAAACCCCTTACCCTTTAGGG - Intergenic
1040418320 8:47216046-47216068 ATAAAATCTGTTTCCTTTTAAGG - Intergenic
1040710724 8:50185370-50185392 ATTAAACCTTTTTCTTTATAAGG + Intronic
1043157512 8:76802584-76802606 GTTAAACCATATTCCTTTAATGG - Intronic
1043749305 8:83915558-83915580 ATTAAACTCCTTCCCTTTTATGG + Intergenic
1044054092 8:87546497-87546519 CTTAGACCTATTTCCTTTCAGGG - Intronic
1044267958 8:90205311-90205333 ATTTAACCTGTTTACTTTTAAGG - Intergenic
1044842072 8:96345079-96345101 GTTCCACCTCTTTCCTTTTGAGG - Intergenic
1045893349 8:107183802-107183824 CTTAAACCTCTTTTTTTCTATGG + Intergenic
1050161605 9:2725403-2725425 GTTAAATCTTTGTCTTTTTAAGG + Intronic
1052162577 9:25284612-25284634 TTTAATCCTCTAACCTTTTAAGG + Intergenic
1052890676 9:33696638-33696660 GATAATTCTCTTTCCTTTTCAGG - Intergenic
1053574662 9:39346136-39346158 ATTAAACCTCTTTTTTTTTTTGG + Intergenic
1054096226 9:60904826-60904848 ATTAAACCTCTTTTTTTTTTTGG + Intergenic
1054721479 9:68608588-68608610 TTTAAACATCTTTCCAGTTAGGG - Intergenic
1055900680 9:81231306-81231328 GGTAAATCTCTTTTTTTTTAAGG - Intergenic
1056544079 9:87598760-87598782 GTTAAACAGGTTTCTTTTTAAGG + Intronic
1058257209 9:102782115-102782137 TTTAAACCTGTTTACTTTGAAGG + Intergenic
1059641230 9:116218905-116218927 GGTAAACCCCTTTCCTTCTCTGG - Intronic
1059773365 9:117448974-117448996 GTTAAATCTCTTGGGTTTTATGG + Intergenic
1060340978 9:122776961-122776983 ATTATACCTCCTTCCTTTTGTGG - Intergenic
1060420470 9:123465725-123465747 TATAAACCTTTTTTCTTTTATGG + Intronic
1060678689 9:125541643-125541665 GTCAAACTTCTTTGCATTTAGGG - Intronic
1060981735 9:127796429-127796451 GTTTGTCCTCTTTCCTTTTTTGG - Intronic
1186361731 X:8849513-8849535 GTTACAGCTTATTCCTTTTAAGG - Intergenic
1186984588 X:14998267-14998289 ATTATACCTCTCTCCTTCTAAGG - Intergenic
1187830759 X:23378996-23379018 GGTAAACCTCTTGTCTTATATGG + Intronic
1190837663 X:54116137-54116159 GGTAAACATTTTTCCTTTTATGG - Intronic
1192602952 X:72484064-72484086 TTCGTACCTCTTTCCTTTTATGG - Intronic
1192915840 X:75650436-75650458 ATTTAACCTCTTTATTTTTAAGG + Intergenic
1193355361 X:80513731-80513753 GGTAAACTTCTTTCTTTTTGAGG + Intergenic
1193416141 X:81226838-81226860 GGTAAAACTCTTTCCTTCTGAGG - Intronic
1193428297 X:81368028-81368050 GTTCTACCTCTTTCATTTAAGGG + Intergenic
1193562917 X:83041802-83041824 GTTAAACTTCTATTCTTCTATGG + Intergenic
1193935925 X:87621699-87621721 TGAAAAACTCTTTCCTTTTATGG - Intronic
1194382418 X:93210941-93210963 TGTAAACTTCTTTCTTTTTAAGG - Intergenic
1194510500 X:94788263-94788285 TTTAAACCACATGCCTTTTAAGG + Intergenic
1194645516 X:96454132-96454154 ATTAAACCTCTTTTTTTTTTTGG - Intergenic
1198661787 X:138976946-138976968 GTAAAACCTCTTTTTATTTATGG - Intronic
1200825425 Y:7633871-7633893 GTAAACCCTCATTCCTTTAATGG + Intergenic
1200957501 Y:8966676-8966698 GTAAACCCTCATTCCTTTAATGG - Intergenic
1202234633 Y:22697216-22697238 GTAAACCCTCATTCCTTTAATGG - Intergenic
1202308526 Y:23498952-23498974 GTAAACCCTCATTCCTTTAATGG + Intergenic
1202562275 Y:26171634-26171656 GTAAACCCTCATTCCTTTAATGG - Intergenic