ID: 1008966991

View in Genome Browser
Species Human (GRCh38)
Location 6:57322654-57322676
Sequence TTAAACCTCTTTCCTTTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 377}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008966989_1008966991 -3 Left 1008966989 6:57322634-57322656 CCTGGGGAACTGTGAGTCAGTTA 0: 3
1: 71
2: 878
3: 2088
4: 2955
Right 1008966991 6:57322654-57322676 TTAAACCTCTTTCCTTTTATGGG 0: 1
1: 0
2: 2
3: 28
4: 377
1008966979_1008966991 30 Left 1008966979 6:57322601-57322623 CCATGATTGTAAGTTTCCTGAGG 0: 5695
1: 8136
2: 6569
3: 4228
4: 2890
Right 1008966991 6:57322654-57322676 TTAAACCTCTTTCCTTTTATGGG 0: 1
1: 0
2: 2
3: 28
4: 377
1008966987_1008966991 2 Left 1008966987 6:57322629-57322651 CCAGCCCTGGGGAACTGTGAGTC 0: 5
1: 251
2: 3897
3: 9101
4: 8936
Right 1008966991 6:57322654-57322676 TTAAACCTCTTTCCTTTTATGGG 0: 1
1: 0
2: 2
3: 28
4: 377
1008966988_1008966991 -2 Left 1008966988 6:57322633-57322655 CCCTGGGGAACTGTGAGTCAGTT 0: 5
1: 252
2: 2812
3: 7427
4: 7818
Right 1008966991 6:57322654-57322676 TTAAACCTCTTTCCTTTTATGGG 0: 1
1: 0
2: 2
3: 28
4: 377
1008966986_1008966991 3 Left 1008966986 6:57322628-57322650 CCCAGCCCTGGGGAACTGTGAGT 0: 7
1: 282
2: 4254
3: 9482
4: 9076
Right 1008966991 6:57322654-57322676 TTAAACCTCTTTCCTTTTATGGG 0: 1
1: 0
2: 2
3: 28
4: 377
1008966982_1008966991 14 Left 1008966982 6:57322617-57322639 CCTGAGGTCTCCCCAGCCCTGGG 0: 1
1: 18
2: 343
3: 2098
4: 5643
Right 1008966991 6:57322654-57322676 TTAAACCTCTTTCCTTTTATGGG 0: 1
1: 0
2: 2
3: 28
4: 377
1008966985_1008966991 4 Left 1008966985 6:57322627-57322649 CCCCAGCCCTGGGGAACTGTGAG 0: 7
1: 261
2: 4036
3: 9123
4: 9341
Right 1008966991 6:57322654-57322676 TTAAACCTCTTTCCTTTTATGGG 0: 1
1: 0
2: 2
3: 28
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008966991 Original CRISPR TTAAACCTCTTTCCTTTTAT GGG Intronic
900758810 1:4456539-4456561 TTAAACCTCTTTTCCTGTCTCGG + Intergenic
901352995 1:8614686-8614708 TTAAAACTGTTTTCTTTTTTAGG - Exonic
904169409 1:28581229-28581251 CTAAACCTCTTACCTGTAATAGG - Intergenic
905404175 1:37722211-37722233 TTCCATCTCTTTCCTTTTCTTGG + Intronic
906395888 1:45464167-45464189 TTAAATATCTTTCCATTTTTTGG + Intronic
906401594 1:45508662-45508684 ATAAACCTCTGTCCTTTTCTTGG - Intronic
907972043 1:59392577-59392599 TTAAAACTCATTCCTTTGAAAGG + Intronic
908514415 1:64877581-64877603 TTAACTCTCTTCCCTTTTCTGGG + Intronic
908704670 1:66938664-66938686 TTAAATCTCATTCCTCTAATGGG - Intronic
909171792 1:72304624-72304646 TTTAACCTATATCCTCTTATTGG + Intergenic
909205069 1:72745453-72745475 ATAAAACTCTTTGCTTTTAATGG - Intergenic
909328969 1:74389578-74389600 TAACACTTATTTCCTTTTATTGG + Intronic
909833060 1:80218145-80218167 TTAAATCTCTTGCCTTTAAAGGG + Intergenic
909930746 1:81496695-81496717 TAAAATTTCTTTCCTTGTATGGG - Intronic
910079342 1:83322587-83322609 AGAAACCTCTTTTTTTTTATTGG + Intergenic
910526391 1:88183744-88183766 TTATTCCTCTTTCTTTTTAAGGG + Intergenic
912354018 1:109041189-109041211 TTAAACCGCTTCCCTTTATTGGG - Intronic
913967275 1:143387089-143387111 TTATAACTTTTTGCTTTTATAGG + Intergenic
914061654 1:144212696-144212718 TTATAACTTTTTGCTTTTATAGG + Intergenic
914117496 1:144753673-144753695 TTATAACTTTTTGCTTTTATAGG - Intergenic
915422374 1:155794071-155794093 TTAAACCTCTTTTTTTTTTCAGG + Intronic
915932048 1:160066916-160066938 TCAAATGTCTTTCCTTTTCTAGG + Intronic
916681119 1:167106022-167106044 TGAAACATCTTTCCTTCTAATGG - Intronic
917347666 1:174045326-174045348 TTTAACACCTTTTCTTTTATTGG + Intergenic
917557658 1:176107325-176107347 AGAAACCTCTTTTCTTTTAGTGG - Intronic
917657399 1:177140267-177140289 TTAACTATCTTTCTTTTTATGGG + Intronic
919569311 1:199226300-199226322 TTAAACATCTTTACTTTTTGGGG - Intergenic
920637322 1:207716499-207716521 TTAAACCTTTTTTTTCTTATTGG + Intronic
921218562 1:212957196-212957218 CAAAACGTCTTTCCTTTTAAAGG + Intronic
921911525 1:220554284-220554306 TTAATCACCTTTCCTTCTATAGG - Intronic
921916529 1:220618035-220618057 TAAAACCTATTTTCTTTCATAGG - Intronic
922139300 1:222866251-222866273 TTTTCCCTCTTGCCTTTTATAGG + Intergenic
924360337 1:243233937-243233959 GTAAACCAGTTTCTTTTTATGGG - Intronic
1062876403 10:946301-946323 TTACACCCCTTTCCTTCTGTGGG + Intergenic
1063272741 10:4529909-4529931 ATAAAACTCTTTCCTTCTGTAGG - Intergenic
1065300858 10:24319843-24319865 TTAAGCCTCTTGACATTTATTGG + Intronic
1067484676 10:46636824-46636846 TTAAAAATTTTTCCTTTTTTAGG + Intergenic
1067610081 10:47704825-47704847 TTAAAAATTTTTCCTTTTTTAGG - Intergenic
1067741693 10:48900297-48900319 TTCAAGCTCTTACCTTTTAAAGG - Exonic
1068023452 10:51613881-51613903 TTAGACTTCTTTTCTTTTTTTGG + Intronic
1068375867 10:56179713-56179735 TTAAGCCTGGTTCCTTTTTTTGG - Intergenic
1068593472 10:58875058-58875080 ATAAACCTGGTTCTTTTTATTGG - Intergenic
1068600227 10:58949064-58949086 TTAAATCTCTTGCTTTATATTGG - Intergenic
1068995570 10:63198982-63199004 TTAAACAGTTTTCATTTTATTGG - Intronic
1069267324 10:66477137-66477159 TTCATCATCTTTACTTTTATTGG - Intronic
1070224273 10:74484120-74484142 TTAAACCTCTTTTCTTTCTAAGG - Intronic
1070413352 10:76165565-76165587 TTAAACCTCTTTTCTTGGCTGGG - Intronic
1070513313 10:77180482-77180504 AAAAACCTCTTTCCTCTTGTAGG - Intronic
1071625665 10:87166440-87166462 TTAAAAATTTTTCCTTTTTTAGG - Intronic
1072474672 10:95748768-95748790 TTAAATCTCTTTTAATTTATAGG + Intronic
1072992347 10:100209000-100209022 TTAAACCTCTGTGATTTAATAGG + Intronic
1073525597 10:104179056-104179078 TTTTATCTCTTTCCTTTTCTTGG + Exonic
1073740794 10:106404122-106404144 TTCAACCTTTTTCTTTTTAGGGG - Intergenic
1073832262 10:107398511-107398533 TATAATCTCTTTCCTTTGATTGG - Intergenic
1074706368 10:116136299-116136321 ATAAACCTAATTCATTTTATGGG + Intronic
1075884025 10:125881442-125881464 TCACAGTTCTTTCCTTTTATAGG - Intronic
1078125675 11:8559966-8559988 TTACACCTCTTTTGTTTTAATGG + Intronic
1078474152 11:11616530-11616552 TTCAACCACTTTCCTATTATTGG - Intronic
1079696677 11:23490454-23490476 TTAAAGCTATTTATTTTTATTGG + Intergenic
1080110859 11:28566404-28566426 ATAAACATATTTCCTTTTTTTGG - Intergenic
1080131114 11:28795597-28795619 TTTAAACTCTTTATTTTTATTGG + Intergenic
1080406237 11:31981965-31981987 TTAAAACTCTTGGCTTATATAGG + Intronic
1080420788 11:32108879-32108901 TTAAAACTCCTCCCTTTCATTGG - Intergenic
1080511321 11:32975226-32975248 ATAAACTTTTTTCTTTTTATAGG + Exonic
1081132973 11:39403050-39403072 GGAAACCTGGTTCCTTTTATGGG - Intergenic
1085090792 11:73711492-73711514 TCAAACCATTTTCCTTTTGTGGG + Intronic
1086224551 11:84491932-84491954 GTAACACACTTTCCTTTTATAGG - Intronic
1086468280 11:87077532-87077554 TTACACCTGTTTCCCTTTTTGGG + Intronic
1087409290 11:97770521-97770543 TTACACATCCTTCCTTTTTTGGG + Intergenic
1087522165 11:99252948-99252970 TTAAATCTCTTTTTTTTTTTTGG + Intronic
1087564713 11:99839559-99839581 TTAACCCTATTTCCTTTTTAAGG - Intronic
1087976787 11:104559398-104559420 TTAAACCTCTGTCTTTTAGTGGG - Intergenic
1089111993 11:116064490-116064512 TTCACCTTCTTTCCTTTCATAGG - Intergenic
1089777705 11:120850174-120850196 TGAAAACTCTTTGCTTTTAAAGG + Intronic
1090168074 11:124572243-124572265 CCAAACCTCTTTCTCTTTATGGG + Intergenic
1090580097 11:128150041-128150063 TTTAACCAATTTCCTATTATAGG - Intergenic
1090751583 11:129750705-129750727 CTAAACCTCATTCTTTTCATGGG - Intergenic
1090937682 11:131359592-131359614 TTAAACCTCTTTTCTTTATAAGG - Intergenic
1091227830 11:133968288-133968310 CTAAACCTCTCTCCCTTTCTTGG - Intergenic
1091250788 11:134142146-134142168 TTAAAGAACTTTCCTTTTCTGGG + Intronic
1091657797 12:2358411-2358433 TTACAACCCTTTCCATTTATTGG + Intronic
1092872764 12:12820824-12820846 TTAATTCTCTTTCCTCTTACAGG + Intronic
1095135838 12:38601879-38601901 TAAAAAATCTCTCCTTTTATGGG - Intergenic
1095342106 12:41102856-41102878 TTAAATCCCTTTCTTTTCATGGG - Intergenic
1095457090 12:42399692-42399714 TTAAATCCGTTTCCTTTTGTTGG + Intronic
1095653616 12:44643001-44643023 TGAAACTGTTTTCCTTTTATTGG - Intronic
1095747649 12:45677405-45677427 TTAAACCTAATTCCTTTCCTTGG + Intergenic
1097369147 12:58754976-58754998 TTGAATCTTTTTTCTTTTATTGG - Intronic
1097438955 12:59586035-59586057 ATTAACCTCTTTGCATTTATTGG - Intergenic
1100006865 12:89905049-89905071 TTAAATTTCTTTCCTTATATGGG - Intergenic
1100036895 12:90262656-90262678 TTAAAAATCTTACCTTTCATAGG + Intergenic
1100148212 12:91703219-91703241 TGAAACTTCTTTTTTTTTATTGG + Intergenic
1101846237 12:108365313-108365335 TTAAACTTTCTTCCTTTTCTTGG + Intergenic
1103359280 12:120344210-120344232 TTTAACCACTTTCCTTTTGATGG + Intronic
1104233361 12:126907271-126907293 TCAAACCCCTTTCATTTTATTGG + Intergenic
1104616111 12:130270648-130270670 GTAAATCTCTTTTCATTTATGGG - Intergenic
1106044504 13:26126063-26126085 TTAAATGTCTTTCTTTTTCTAGG + Intergenic
1106485659 13:30170471-30170493 TTCAACATCTTTCTTGTTATAGG - Intergenic
1106948612 13:34857121-34857143 TGAAAAATGTTTCCTTTTATAGG - Intergenic
1106992885 13:35444274-35444296 TTAAATCTTTTTCCTTTTAGTGG + Intronic
1109173584 13:59126872-59126894 CTAATCCTCTCTCCTTTTAACGG + Intergenic
1109835755 13:67854642-67854664 TTAAACTTCATTCCTTTTCAAGG - Intergenic
1110293484 13:73835060-73835082 TTAAACCTTTTTTTTTTTTTTGG + Intronic
1110580885 13:77123853-77123875 TTAAACATTTTTCTTTATATAGG - Intronic
1111081418 13:83314114-83314136 TTAAATATATTTTCTTTTATAGG + Intergenic
1111331719 13:86766686-86766708 TTAAACCTCTTTCCTTTATAAGG - Intergenic
1111578211 13:90187045-90187067 ATAAACCTACTTCCTTTGATAGG + Intergenic
1112894190 13:104278193-104278215 TAAAACCTGTTTTCCTTTATAGG - Intergenic
1112943277 13:104893058-104893080 TTATACCTGTTTGCATTTATTGG + Intergenic
1113150550 13:107258760-107258782 ATAAACATGTTTCCTTTTGTAGG - Intronic
1115272242 14:31566467-31566489 TTCAACTTGCTTCCTTTTATGGG + Intronic
1117195671 14:53337701-53337723 TTAAACCTATATTATTTTATTGG - Intergenic
1117283823 14:54266691-54266713 TTAAACCTCTTTCCTTTGGCTGG + Intergenic
1117709120 14:58505559-58505581 TTAAACCAATTTATTTTTATCGG + Intronic
1118824360 14:69367047-69367069 TTATACCTTCTTCCTTTTAGGGG - Intergenic
1119436896 14:74603443-74603465 TTAAACCTCTTCCCTTCCATTGG + Intronic
1120512461 14:85432533-85432555 TTTAAACACATTCCTTTTATAGG - Intergenic
1120965543 14:90164399-90164421 TGAAACCTCATTCTTTTTAGAGG - Intronic
1121045095 14:90781925-90781947 ATAAATCTGTTTCCTTATATAGG - Intronic
1121628275 14:95403214-95403236 TTAAAATTCTTTTCTTTTAATGG - Intergenic
1122089578 14:99329306-99329328 TTAAACCTCTTTCCTTGGCCGGG + Intergenic
1124467561 15:29951931-29951953 TTAAACCTCCTTCCTAAAATAGG - Intronic
1126835198 15:52655815-52655837 TTCAAGCTCTTTCCACTTATAGG + Intronic
1127210878 15:56773369-56773391 CTCAACCTCTTGCCTTTTCTTGG - Intronic
1127512498 15:59656968-59656990 TTAAAATTCGTTCCTTTTGTCGG + Intronic
1127851954 15:62920993-62921015 CAAAACCTCTTGGCTTTTATGGG + Intergenic
1128016079 15:64348586-64348608 TTAATCCTCTTGCCTTTTCCTGG + Intronic
1128438000 15:67674579-67674601 TTAAGCCTCTTTCCCCATATTGG + Intronic
1128444449 15:67745048-67745070 ATGAACCTCTTCCCTTTTCTGGG - Intronic
1131252422 15:90839206-90839228 CCAAACCTCATTCTTTTTATGGG + Intergenic
1131678382 15:94695323-94695345 TTAAAAGTTTTTTCTTTTATGGG - Intergenic
1133232758 16:4374240-4374262 CTCAGCCTCCTTCCTTTTATCGG + Intronic
1133689063 16:8195508-8195530 ATAACCTTTTTTCCTTTTATTGG + Intergenic
1135810860 16:25585519-25585541 TTAAATCTATTTCCTATCATTGG - Intergenic
1137306843 16:47209349-47209371 TTATGCTTCTTTGCTTTTATTGG - Intronic
1137545973 16:49403810-49403832 TTGAAACTCTTTCCTTCTATAGG - Intergenic
1138928965 16:61628989-61629011 TTCAGCCACTTTTCTTTTATAGG - Intergenic
1140811883 16:78586293-78586315 CCAAACCTCTTTCTTTTTAAAGG - Intronic
1143740694 17:8951572-8951594 TTGAACCTCATTCCTTTTTAAGG + Intronic
1143996940 17:11014625-11014647 GAACATCTCTTTCCTTTTATAGG + Intergenic
1144635804 17:16908248-16908270 TTACACCTCTTGGCTTTTACAGG - Intergenic
1145893257 17:28434008-28434030 TGAAACCTATATCCTTTAATTGG + Intergenic
1146363692 17:32200934-32200956 TTTAAACTCTTTTCTTTCATAGG + Exonic
1146900534 17:36583384-36583406 TTCAATCTGTTTCCATTTATTGG + Intronic
1147283003 17:39378033-39378055 TAAAATCTCTGTCCTTTTTTTGG - Intronic
1147518279 17:41142867-41142889 TAAAACCTGTTTCCTGTTTTTGG - Intergenic
1148879767 17:50716993-50717015 TGAAACCTCTGGCCTTTGATAGG - Intergenic
1153850191 18:9086653-9086675 TTATAAATCTTTCCCTTTATAGG - Intergenic
1155330394 18:24709952-24709974 TGAAAACTTTCTCCTTTTATGGG + Intergenic
1155606160 18:27608470-27608492 TTAAACCTCTTCTGTTTTTTGGG + Intergenic
1155634077 18:27930641-27930663 GAAAACCATTTTCCTTTTATTGG - Intergenic
1155828963 18:30487571-30487593 ATAATACCCTTTCCTTTTATTGG - Intergenic
1156056624 18:33013069-33013091 TAACACATTTTTCCTTTTATAGG + Intronic
1158062280 18:53359665-53359687 TTAATCATCTTTCCTTTTCATGG - Intronic
1158463921 18:57672458-57672480 TTAAACCTGTATATTTTTATTGG + Intronic
1158719033 18:59907263-59907285 TCAAACGTCTTTCCTTTGAAAGG - Intergenic
1158981261 18:62764258-62764280 TTATACCTCTGTTCATTTATAGG + Intronic
1159183103 18:64935414-64935436 TTAATCCTCTTCACTTTTATAGG + Intergenic
1160041748 18:75351813-75351835 TTAATCCTGTTCCCTTTCATTGG - Intergenic
1162544594 19:11321192-11321214 TTAAACCTCTTATGTTTTTTTGG - Intronic
1164490433 19:28707412-28707434 TTAAACCTCTTTTCTTTATCAGG + Intergenic
1164568937 19:29354550-29354572 TTAAAACTATATCCATTTATAGG + Intergenic
1168438464 19:56342315-56342337 AAAAACCTCTTTCTTTTTTTTGG + Intronic
1202701061 1_KI270712v1_random:164583-164605 TTATAACTTTTTGCTTTTATAGG + Intergenic
925242956 2:2348993-2349015 TTATTCCTCTGTCCTATTATTGG - Intergenic
925787074 2:7442153-7442175 TTAAAACTCTTTCCTTTACACGG + Intergenic
926404611 2:12538430-12538452 TGACACCTCCTTCATTTTATCGG + Intergenic
927303771 2:21546425-21546447 TTAAAGCTCAATCCTTGTATTGG + Intergenic
928017518 2:27671794-27671816 TTTCACATCTTTCCTTTTCTTGG + Intronic
929438918 2:41950064-41950086 TTATACCTCATTCCTTTGGTGGG + Intronic
930563020 2:52984552-52984574 TTAATTTTCTTTTCTTTTATGGG + Intergenic
930904109 2:56545582-56545604 TTGAACATCTTTCCTATTATGGG + Intergenic
931454797 2:62400486-62400508 TTCATCCTCTTTCCTTTCTTTGG + Intergenic
931856909 2:66311967-66311989 TGAAACCCCTTTCCTTTGTTTGG - Intergenic
931917459 2:66973109-66973131 ATAAACATGTATCCTTTTATTGG + Intergenic
932553937 2:72801845-72801867 TTAAAACCATTTCATTTTATAGG + Intronic
932914530 2:75841676-75841698 TTTATGTTCTTTCCTTTTATGGG + Intergenic
932930262 2:76027904-76027926 TTACACCTGTTCCCTATTATTGG + Intergenic
933256419 2:80086279-80086301 TTAAAGTTCCTTCCTTCTATAGG + Intronic
933819953 2:86101959-86101981 TTGAACTTTTTTCCTTTTTTAGG + Intronic
934017458 2:87903692-87903714 TGAAACCTCTTTGCTATTGTGGG + Intergenic
934171988 2:89548060-89548082 TTATAACTTTTTGCTTTTATAGG + Intergenic
934282296 2:91622378-91622400 TTATAACTTTTTGCTTTTATAGG + Intergenic
934633627 2:95959798-95959820 TTAACCCTCTTTGTTATTATTGG - Intronic
934881723 2:97987560-97987582 TTAAATGTCTTTCATTTTATAGG + Intronic
934889940 2:98058578-98058600 TCCCACCTCTTTCCATTTATTGG - Intergenic
935017096 2:99193692-99193714 GTAAACCTCATTCATTTTAATGG + Intronic
935406184 2:102712080-102712102 TTAATCCTTTTTTATTTTATTGG + Intergenic
935763969 2:106346118-106346140 TTAATCCTCTTTTCCTTTAGTGG + Intergenic
936677189 2:114729004-114729026 TTAAACCTCCCTCCCATTATGGG - Intronic
937102733 2:119284040-119284062 TAAAACCGCTTTCCTCTCATGGG - Intergenic
937766740 2:125669981-125670003 TTCTACCACTGTCCTTTTATTGG + Intergenic
938926530 2:136048217-136048239 TTAAGCTTCTCTCCTTTTACAGG - Intergenic
939176135 2:138749315-138749337 TTAAACCTCTTTCCTTGTCTTGG + Intronic
939658923 2:144863106-144863128 TGAAAACTCTTTAGTTTTATAGG + Intergenic
940616170 2:156051329-156051351 TTAAACCTCTTTTCTTTATCAGG - Intergenic
941025934 2:160456269-160456291 TTAAACCTCTTACCAGCTATAGG + Intronic
941344558 2:164351356-164351378 GAAAACCTCTTTCCATCTATAGG - Intergenic
943462760 2:188189971-188189993 TCAAACCTGTTACCTTCTATAGG + Intergenic
943642586 2:190375684-190375706 TTAAATTTATTTCTTTTTATAGG - Intergenic
944796964 2:203197280-203197302 CTAAACCTCTTTTATTTTATAGG + Exonic
945964977 2:216176808-216176830 TGAAACCTCTTTTCTAATATAGG + Intronic
947941020 2:234054942-234054964 TTCAACCTCTTTGCATTTTTTGG + Intronic
1170119607 20:12897280-12897302 TTAAAGTTCTTTCCTTATCTTGG + Intergenic
1170125834 20:12963269-12963291 TAAACATTCTTTCCTTTTATGGG - Intergenic
1170498512 20:16950610-16950632 TTCAAACTCATTCCTTTCATGGG - Intergenic
1171227292 20:23452218-23452240 GTAAACATCTTACGTTTTATTGG + Intronic
1172087845 20:32402141-32402163 TTAACACTGTTTCTTTTTATTGG + Intronic
1172456485 20:35078669-35078691 TTTAGTCTCTTTCCTTTGATTGG - Intronic
1173381030 20:42541770-42541792 TTATCCATCTTTCCTTTTATGGG - Intronic
1173392705 20:42649112-42649134 TTAAACCTCTTTCCTTGGCCGGG - Intronic
1173961843 20:47079667-47079689 TTTAACCTGTTTCCTGTTAATGG - Intronic
1173962555 20:47086369-47086391 TTAAACCTCTTTTCTTTAGCTGG - Intronic
1174920528 20:54697100-54697122 TTAAACCTCTTTTTCTATATAGG + Intergenic
1175326979 20:58136734-58136756 TTAGACCTCCTGCCTTTCATGGG + Intergenic
1175428624 20:58888073-58888095 TTAAATGTGTTTCCATTTATAGG + Intronic
1175490665 20:59379129-59379151 TGAAACTTCTTTCCTTTTGATGG + Intergenic
1176692309 21:9929737-9929759 ATCAACCCTTTTCCTTTTATTGG - Intergenic
1176890558 21:14312923-14312945 TTTAACCTCTTTCTTTTTTAGGG + Intergenic
1177879696 21:26677648-26677670 TCAAAGCTCTTGCCTTTTAAAGG - Intergenic
1178006230 21:28223291-28223313 TTAAAACTCTCTCTTTATATGGG + Intergenic
1178122644 21:29484932-29484954 TTAAACCTCTTTTTCTTTATAGG - Intronic
1178378605 21:32089791-32089813 GTATGCCCCTTTCCTTTTATAGG - Intergenic
1179187988 21:39099445-39099467 TTACACTTTTTTGCTTTTATAGG + Intergenic
1182683384 22:32100853-32100875 TGAAACCTGTTTCCTTTCCTGGG + Intronic
1183124788 22:35766535-35766557 TTCAAGCTCTTTCCTCATATGGG - Intronic
1183156132 22:36076704-36076726 TCAAACCTCTTTGTTTTTTTTGG + Intergenic
1185302111 22:50087281-50087303 TTAAAGCTCTTTCCTTTATAAGG + Intergenic
951364103 3:21759439-21759461 TTAAGCCTTTTTCCTTGAATGGG - Intronic
951453938 3:22869852-22869874 TTACATTTCTTTCCTTTAATGGG - Intergenic
952181668 3:30923179-30923201 TTAAAGTTCTTTCTTTTTAATGG - Intergenic
953648667 3:44779299-44779321 TGAACCCTAATTCCTTTTATTGG + Intronic
954877955 3:53815481-53815503 TTAAACCTCATTCCTGTTTATGG + Exonic
955312353 3:57901717-57901739 TTAAATCTCTTTTAATTTATAGG - Intronic
956740490 3:72271952-72271974 TTAAACTTCTTTTCTTCTGTGGG - Intergenic
956964099 3:74438582-74438604 TTTATCCTCTTGCTTTTTATAGG + Intronic
958631842 3:96694684-96694706 TGAAATATCTTTCCTTTTTTTGG + Intergenic
959275730 3:104275334-104275356 TTAAACCTCTAACATTTAATGGG - Intergenic
959655271 3:108797142-108797164 GTAACCCTGGTTCCTTTTATTGG - Intergenic
960307022 3:116074296-116074318 TCAAACCTCTTCCCTGTTTTGGG - Intronic
960635241 3:119778664-119778686 TGAAACCTCTTTTCATTTTTAGG - Intergenic
961560791 3:127728063-127728085 TTAAATTTCTTTCCATTTGTAGG + Intronic
962027410 3:131562940-131562962 TTAAAGCTCTTTGATTTTACTGG + Intronic
962032190 3:131612800-131612822 TAAAACCTATTTCCTATTGTTGG + Intronic
962189743 3:133297909-133297931 TGACACCTCTTTCCCATTATTGG + Intronic
963295154 3:143537875-143537897 TCAAACTCCTTTCCATTTATAGG + Intronic
963574963 3:147048515-147048537 TTCAACCTCTTTCCTTAACTTGG - Intergenic
963778909 3:149467080-149467102 ATAAACCTTTTCCCTTTTATAGG - Intergenic
964963518 3:162458919-162458941 TTGAACCACTTCCCTGTTATTGG - Intergenic
964973133 3:162585760-162585782 TTAAACATCATTTCTTTTATTGG - Intergenic
965394368 3:168143881-168143903 TTAAGCCTCTTTCCTTTTTTGGG - Intergenic
966331791 3:178822834-178822856 TTACACTTCTTCTCTTTTATGGG + Intronic
966332239 3:178827094-178827116 TTAATACGCTTTCCTTTTGTTGG - Intronic
967449603 3:189609186-189609208 TTAGACATCTTTCCATGTATGGG + Intergenic
967766513 3:193285845-193285867 TTAAATGTCTTTACTTTTGTGGG - Intronic
968694390 4:2015575-2015597 TTAAATTATTTTCCTTTTATAGG + Intronic
971109702 4:23571845-23571867 TTAAATCTCTGTCCTTTACTGGG + Intergenic
971368641 4:25997342-25997364 TTAAACCTCTTTTAATTTCTAGG - Intergenic
971641719 4:29142619-29142641 TTAAATACCTTTCATTTTATGGG + Intergenic
972105052 4:35474041-35474063 CTAAACCTCTTTAATTTTAAGGG - Intergenic
972238833 4:37166496-37166518 TTAATATTCTTTCCTTTTAATGG - Intergenic
972392907 4:38629962-38629984 TTTAACCAATTTCCTGTTATTGG + Intergenic
973657788 4:53067738-53067760 TTAAACCTCTTTTGTTTCTTGGG + Intronic
974316582 4:60290114-60290136 TTCAACCAATTTCCTTTTACTGG + Intergenic
975442697 4:74431001-74431023 TTAGATTTCTTTCCTTTCATAGG - Intergenic
975546509 4:75565810-75565832 TTATCTCTCTTTCCTTTTTTAGG - Intronic
975796996 4:78017097-78017119 TTAAAATTCTTTCCTTTCTTTGG - Intergenic
975933317 4:79553388-79553410 TTAGACCTCTTTCCTCTTTTTGG - Intergenic
976533040 4:86177962-86177984 TTAAACATGTTGCCTTTTTTTGG - Intronic
976579946 4:86724479-86724501 AAAAACCTGTTTCCTTTTTTAGG + Intronic
976649388 4:87418851-87418873 TTAAACCTCTTTTCTATTGGGGG - Intergenic
977425279 4:96860866-96860888 TTAAAGTTCTTTCCCTTTACTGG + Intergenic
977662395 4:99605785-99605807 TTTAGCATCTTTCCTTCTATTGG + Intronic
978068392 4:104435041-104435063 TTACATCTCTCTCCTTTTCTGGG - Intergenic
978152487 4:105453642-105453664 TTCACCATCTTTTCTTTTATAGG - Exonic
980272978 4:130611103-130611125 TTTAACCACTTACCTTTTATGGG - Intergenic
980364903 4:131789973-131789995 GTCAACCCTTTTCCTTTTATTGG - Intergenic
980582691 4:134774102-134774124 TTAAACTTCTTTTTCTTTATAGG + Intergenic
981428026 4:144626473-144626495 TTCAACCTCTTTCTCTTCATGGG - Intergenic
981837329 4:149069836-149069858 TGAAATCTCTTTCCTTTTTAGGG - Intergenic
982754383 4:159201493-159201515 ATTATCCTCTATCCTTTTATAGG - Intronic
982960484 4:161829306-161829328 ATTAAACTATTTCCTTTTATGGG + Intronic
983706754 4:170670511-170670533 TTAAGCCTCTTTCATTTCTTGGG + Intergenic
984617835 4:181918701-181918723 TTAAACTTCTTTTTTTTTAAAGG - Intergenic
987633328 5:20505781-20505803 CTAAACTTCTTTACTTTCATGGG - Intronic
988767891 5:34401658-34401680 TTGAACCTCTTTTTTTTTTTTGG + Intergenic
990430533 5:55730763-55730785 ATAATCCTCTTTTCTTTTAATGG + Intronic
990677483 5:58204079-58204101 GTAAAGCTTTTTCCTTTTTTAGG + Intergenic
990946336 5:61253572-61253594 ATGAAGCTCTTTCCTTTTCTGGG + Intergenic
992702702 5:79357007-79357029 TTAAAGCTCTTTCAAATTATTGG - Intergenic
992880051 5:81098791-81098813 TTCAAGCATTTTCCTTTTATAGG + Intronic
993199608 5:84797501-84797523 TTCATCCTTTTTCATTTTATTGG + Intergenic
993521679 5:88910459-88910481 TTATAGCTCTTTCCTTTGAAAGG - Intergenic
993733845 5:91452285-91452307 TTAAACCTCTACCCTTCTACAGG - Intergenic
993823924 5:92657460-92657482 TTCAACATTTTTCCTTTTCTAGG - Intergenic
994895143 5:105693481-105693503 TTAAACCTCTTTCCTTTGTCTGG + Intergenic
994952220 5:106478798-106478820 TTTAACATCTTTCTTTTTATAGG + Intergenic
995398074 5:111710103-111710125 TTATAATTTTTTCCTTTTATAGG + Intronic
995836145 5:116401463-116401485 TTAAACCTTTTTTTTTTTAATGG - Intronic
996252842 5:121358606-121358628 ATAAACCTATTTCCATATATTGG + Intergenic
997884039 5:137614950-137614972 TTAGACCTGTTTCCTTTCCTCGG - Intergenic
999332402 5:150684749-150684771 TTAAAACATTTTCCTTTTCTAGG - Intergenic
999361469 5:150989825-150989847 TTAACCCTCTTGCCTTTACTAGG + Intergenic
999624220 5:153503089-153503111 TTTAAGCTGTCTCCTTTTATGGG + Intronic
1000782825 5:165504917-165504939 GCCAACCTCTTTCCTTTTGTTGG - Intergenic
1001423558 5:171606519-171606541 ATAACCCTGGTTCCTTTTATTGG + Intergenic
1001911172 5:175519445-175519467 TTTATCCATTTTCCTTTTATTGG - Intronic
1004559196 6:16731112-16731134 CTAAACCTCCTTCCATTTGTAGG - Intronic
1005610603 6:27520233-27520255 TTAAAGCTCTATCATTCTATGGG - Intergenic
1006063375 6:31442321-31442343 TTAAACCTTTTTCTTTATAAGGG + Intergenic
1007123784 6:39406916-39406938 TTAAACTTTTTTCTTTTTTTTGG + Intronic
1007456580 6:41982365-41982387 TTAAACTTATTTCATTTTAGGGG - Intronic
1008494570 6:52119928-52119950 TTAAGCCTAATACCTTTTATGGG - Intergenic
1008713759 6:54262930-54262952 TGAGACCTGTTTCTTTTTATTGG - Intronic
1008966991 6:57322654-57322676 TTAAACCTCTTTCCTTTTATGGG + Intronic
1009747921 6:67843936-67843958 TTAATCTTCTTTATTTTTATTGG - Intergenic
1009907178 6:69884364-69884386 TTAAACATTTTTCCTCTCATTGG - Intronic
1010200077 6:73274707-73274729 TTAAACCTCTTTTCTTTGTAAGG + Intronic
1010392521 6:75353958-75353980 CTAAACTTCTTTCCTTTTTTGGG + Intronic
1012784522 6:103606447-103606469 TTAAACATCTTTTTTTTTAATGG - Intergenic
1014658765 6:124139831-124139853 TTATTTCTCTTTCCTTTTCTTGG + Intronic
1014857580 6:126420767-126420789 TTAAGCATCTTTCCCTTTGTAGG - Intergenic
1015012546 6:128368342-128368364 TAATACATCTCTCCTTTTATTGG - Intronic
1016389206 6:143558131-143558153 ATAAATCTCTTTCCATCTATAGG - Intronic
1017337203 6:153275416-153275438 GTAAACATCTTTCTTTTTGTGGG + Intergenic
1018568193 6:165179637-165179659 TTTAACCATTTTCCTGTTATTGG - Intergenic
1019863067 7:3678434-3678456 TCAAAGCTCCTGCCTTTTATGGG - Intronic
1020431170 7:8117666-8117688 TTAAAACTGTATCCTTTTATTGG + Intronic
1020480139 7:8649048-8649070 TTACACCTTTTTCCTTTTGATGG + Intronic
1020796547 7:12684521-12684543 AATAACCTATTTCCTTTTATTGG - Intergenic
1021231557 7:18091763-18091785 TTCAAGCTCTTTTCTATTATTGG + Intronic
1021700262 7:23312460-23312482 TCAAAGCTCTGTCCTTTTCTAGG - Exonic
1022738573 7:33099436-33099458 TTATACCTGTTCCCTTTTTTAGG - Exonic
1029211534 7:98912627-98912649 TTAAACCTATTTTCTTTTTTTGG + Intronic
1029834270 7:103292711-103292733 CAAAACCTTTTTCTTTTTATGGG - Intergenic
1029848045 7:103433614-103433636 TTAAATGCATTTCCTTTTATAGG - Intronic
1031098064 7:117444504-117444526 TCAACCCTCTTTACTGTTATAGG + Intergenic
1031103378 7:117509827-117509849 TTGAATCTGTCTCCTTTTATAGG - Intronic
1031279481 7:119779089-119779111 TGAATCCTATCTCCTTTTATTGG - Intergenic
1031385451 7:121144583-121144605 TTAGACCTTATTCCTTCTATTGG - Intronic
1031466022 7:122112876-122112898 TTACATCTCTTTCCCATTATAGG - Intronic
1031693820 7:124823804-124823826 TTAAATCTCTTGGCTTTTACTGG - Exonic
1031756249 7:125646752-125646774 TTAAACCTTTATCCCTTTTTTGG + Intergenic
1031823781 7:126536349-126536371 TTCAAGCTCTATCCTTTTAGAGG + Intronic
1034679014 7:152913926-152913948 TTCACCCTCTTTGCTATTATAGG - Intergenic
1036383597 8:8258211-8258233 TTCTATCTCTTTCCTTTTCTGGG + Intergenic
1037363826 8:18102080-18102102 ATAAACCTCTTTCCTTTATTTGG - Intergenic
1038287002 8:26214165-26214187 TTCCAACTCTTTCCTTTTTTCGG + Intergenic
1039236620 8:35509270-35509292 GTAAACCTATTTTCTTTGATTGG - Intronic
1039351653 8:36770141-36770163 TTAAACCTCCTTCCTCTTTCTGG - Intergenic
1039507005 8:38059454-38059476 TTAAACCTCTTTTCTTGGCTGGG + Intronic
1039666142 8:39531109-39531131 TTAAACCTGATGCATTTTATTGG + Intergenic
1039976263 8:42367954-42367976 TAAAACCTCTTTCATTTCCTCGG - Intronic
1040714304 8:50229031-50229053 ATAAACCACTTTACTTGTATAGG - Intronic
1040726565 8:50387801-50387823 CCAACCCTCTTTTCTTTTATAGG - Intronic
1042121239 8:65490641-65490663 TTAACCTTCCTTCTTTTTATTGG - Intergenic
1042455243 8:68994240-68994262 TTTAACGTCTTGCCTTCTATTGG + Intergenic
1042596800 8:70458128-70458150 GTTCACATCTTTCCTTTTATCGG + Intergenic
1042769720 8:72366409-72366431 TTACTCCTCTTGCCTTTTTTTGG + Intergenic
1042994236 8:74677254-74677276 ATACACCTCTTTCCTTTCAAAGG + Intronic
1045687918 8:104730382-104730404 GTAAACCTCTTTCATTTTTTAGG + Intronic
1046505013 8:115125959-115125981 TTATACCTCCCTCCTGTTATTGG + Intergenic
1046701514 8:117406056-117406078 TCACACCTCTTTCATTTTAGAGG + Intergenic
1048731476 8:137446209-137446231 TAAAACATCTTTCTTTTTAAAGG - Intergenic
1049314814 8:141959105-141959127 TTAATTTTCTTTCCTTTTACTGG - Intergenic
1050137828 9:2486380-2486402 TTCAACCAGTTTCCTATTATTGG - Intergenic
1050824623 9:9930877-9930899 TCAAATTTCTTTCCTTTTAAAGG + Intronic
1050865674 9:10495110-10495132 ATAAACTTCTTTCCTATTAAAGG - Intronic
1051374735 9:16391618-16391640 TCAAAATGCTTTCCTTTTATAGG + Intergenic
1052236820 9:26220646-26220668 TTAAACCTCTTTTGTTTTTGAGG + Intergenic
1052665566 9:31490952-31490974 CTAAGCCTTTTTCCTTTTCTAGG - Intergenic
1053629256 9:39915847-39915869 ATCAACCCTTTTCCTTTTATTGG - Intergenic
1053776509 9:41547727-41547749 ATCAACCCTTTTCCTTTTATTGG + Intergenic
1054214631 9:62334855-62334877 ATCAACCCTTTTCCTTTTATTGG + Intergenic
1054365223 9:64330758-64330780 ATCAACCCTTTTCCTTTTATTGG - Intergenic
1054672849 9:67820492-67820514 ATCAACCCTTTTCCTTTTATTGG - Intergenic
1056153370 9:83810540-83810562 TTAAATCTCTTTCCAGTTTTGGG + Intronic
1056357266 9:85813872-85813894 TTAAATCTCTTTCCAGTTTTGGG - Intergenic
1056845630 9:90035364-90035386 CTAAACCTCCCTCCTCTTATAGG + Intergenic
1056867172 9:90238350-90238372 TTCTACTTCTTTTCTTTTATGGG + Intergenic
1056957862 9:91096855-91096877 TCAATACTCCTTCCTTTTATAGG + Intergenic
1060099987 9:120831640-120831662 GTAAACCCCTTTCATTTTCTAGG - Intronic
1060981734 9:127796428-127796450 TTTGTCCTCTTTCCTTTTTTGGG - Intronic
1186920580 X:14274863-14274885 CTAAACCTCTTTCCTAATTTTGG - Intergenic
1188414863 X:29920457-29920479 TTTAACGACTTTCCTTGTATAGG - Intronic
1189010037 X:37037856-37037878 TCTCACCTCTTTCCTTTCATAGG - Intergenic
1189038547 X:37517874-37517896 TCTCACCTCTTTCCTTTCATAGG + Intronic
1189131177 X:38499422-38499444 TTAAAATTCTGTCCTTTTAATGG + Intronic
1189561335 X:42194331-42194353 TTCACCCTCTTTCCCTTTCTGGG + Intergenic
1190619279 X:52269358-52269380 TAAGACCTGTTTCCTTTTTTTGG - Intergenic
1191666734 X:63710233-63710255 TTAAATCTTTTTCTTGTTATAGG - Intronic
1192602060 X:72475351-72475373 TTAAACCTATTGCATTTGATGGG + Intronic
1192602951 X:72484063-72484085 TCGTACCTCTTTCCTTTTATGGG - Intronic
1194653291 X:96541665-96541687 TTAAAACTCTGACCATTTATGGG + Intergenic
1194832376 X:98639722-98639744 TTATACCTCTTCCTTTTTATTGG - Intergenic
1195585799 X:106564337-106564359 TTAGACCTCTATCCTCTTACTGG + Intergenic
1196486982 X:116223369-116223391 TTCAACATCTTTCTCTTTATTGG - Intergenic
1197557463 X:127974355-127974377 TTAAACCTGATTCCTTTTTGTGG - Intergenic
1197850596 X:130854973-130854995 TGAATACTCTTTCCTATTATTGG + Intronic
1198296113 X:135288585-135288607 TTAAATACATTTCCTTTTATTGG - Intronic
1198821960 X:140657678-140657700 TTAACTATCTTTGCTTTTATAGG + Intergenic
1199127025 X:144134853-144134875 TGAAACCTCTTTGCTATTGTGGG - Intergenic
1199529018 X:148826147-148826169 TTAAACCTCTACCTTTTTTTTGG - Intronic
1199917898 X:152364126-152364148 TTCAACCTTTTCCTTTTTATTGG - Intronic
1200207840 X:154330405-154330427 TAAAAGCTCTTTCCTTATTTAGG - Intergenic
1201955830 Y:19621469-19621491 CAAATCCTCTCTCCTTTTATTGG - Intergenic
1202306030 Y:23472132-23472154 TTAAAACTGTTTTCTTTTTTAGG + Intergenic
1202564779 Y:26198457-26198479 TTAAAACTGTTTTCTTTTTTAGG - Intergenic