ID: 1008966994

View in Genome Browser
Species Human (GRCh38)
Location 6:57322669-57322691
Sequence TTTATGGGTTTACTCAGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 150}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008966989_1008966994 12 Left 1008966989 6:57322634-57322656 CCTGGGGAACTGTGAGTCAGTTA 0: 3
1: 71
2: 878
3: 2088
4: 2955
Right 1008966994 6:57322669-57322691 TTTATGGGTTTACTCAGTCTTGG 0: 1
1: 0
2: 2
3: 14
4: 150
1008966988_1008966994 13 Left 1008966988 6:57322633-57322655 CCCTGGGGAACTGTGAGTCAGTT 0: 5
1: 252
2: 2812
3: 7427
4: 7818
Right 1008966994 6:57322669-57322691 TTTATGGGTTTACTCAGTCTTGG 0: 1
1: 0
2: 2
3: 14
4: 150
1008966987_1008966994 17 Left 1008966987 6:57322629-57322651 CCAGCCCTGGGGAACTGTGAGTC 0: 5
1: 251
2: 3897
3: 9101
4: 8936
Right 1008966994 6:57322669-57322691 TTTATGGGTTTACTCAGTCTTGG 0: 1
1: 0
2: 2
3: 14
4: 150
1008966985_1008966994 19 Left 1008966985 6:57322627-57322649 CCCCAGCCCTGGGGAACTGTGAG 0: 7
1: 261
2: 4036
3: 9123
4: 9341
Right 1008966994 6:57322669-57322691 TTTATGGGTTTACTCAGTCTTGG 0: 1
1: 0
2: 2
3: 14
4: 150
1008966986_1008966994 18 Left 1008966986 6:57322628-57322650 CCCAGCCCTGGGGAACTGTGAGT 0: 7
1: 282
2: 4254
3: 9482
4: 9076
Right 1008966994 6:57322669-57322691 TTTATGGGTTTACTCAGTCTTGG 0: 1
1: 0
2: 2
3: 14
4: 150
1008966982_1008966994 29 Left 1008966982 6:57322617-57322639 CCTGAGGTCTCCCCAGCCCTGGG 0: 1
1: 18
2: 343
3: 2098
4: 5643
Right 1008966994 6:57322669-57322691 TTTATGGGTTTACTCAGTCTTGG 0: 1
1: 0
2: 2
3: 14
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008966994 Original CRISPR TTTATGGGTTTACTCAGTCT TGG Intronic
904182666 1:28677692-28677714 TTTATGGGTTCAGTTATTCTAGG + Intronic
905633974 1:39536836-39536858 TTTATGGATTTTCCCATTCTAGG - Intergenic
906970138 1:50504665-50504687 TTTATTTGTTTATTCAGTTTAGG - Intronic
907058368 1:51394131-51394153 TTTATTGGTTTACTGATACTGGG + Intronic
908289748 1:62652564-62652586 TTTATGGGTTTACTGTGTGCTGG - Intronic
912059483 1:105648291-105648313 TTTCTGGGATTGTTCAGTCTGGG + Intergenic
912164301 1:107024025-107024047 TTTATAAATTTACCCAGTCTCGG - Intergenic
912349834 1:109001287-109001309 TTTATTGATTTATTCATTCTTGG - Intronic
917570755 1:176263013-176263035 TTTGTTGGTTACCTCAGTCTTGG + Intergenic
917606987 1:176641641-176641663 ATTTTGGGTTTACTTAGTATAGG + Intronic
917805948 1:178613862-178613884 TTCCAGGGCTTACTCAGTCTAGG - Intergenic
922799268 1:228357302-228357324 TTTATGGGTTCACCCAGTTCTGG - Intronic
924523458 1:244825855-244825877 TCTCTGGGTTTCCTTAGTCTAGG - Intergenic
1064233413 10:13550322-13550344 TTTATGTTTTTACTAAATCTGGG - Intergenic
1065118424 10:22504724-22504746 TTGATGGGTCTGCTCTGTCTTGG - Intergenic
1066642342 10:37567361-37567383 TTTCTTTTTTTACTCAGTCTTGG + Intergenic
1068640215 10:59396297-59396319 TTAAAAGGTTTACTGAGTCTAGG - Intergenic
1069544832 10:69320395-69320417 TTTATGGCTTTAAGCACTCTGGG + Intronic
1070950508 10:80427368-80427390 TTTATGGGATTTATCCGTCTGGG + Exonic
1074116831 10:110462592-110462614 TTCATGGCATTTCTCAGTCTTGG - Intergenic
1075424769 10:122332914-122332936 TATAGGGGTGAACTCAGTCTGGG + Intronic
1080769558 11:35327903-35327925 TTTATGGGTATACTCTTTCTTGG + Intronic
1080955885 11:37094938-37094960 TTTATAAATTTACCCAGTCTTGG + Intergenic
1082266042 11:50119532-50119554 TTTATGGGTTTATTCTGTCTTGG - Intergenic
1082290046 11:50359040-50359062 TTTATGGGTTTATTCTGTCTTGG + Intergenic
1083278864 11:61613191-61613213 TTTTTGGGTTTCCTTTGTCTTGG - Intergenic
1084987780 11:72892269-72892291 TTTATGTGTCTACTAAGACTTGG + Intronic
1086214280 11:84359142-84359164 TTTAAAGGCTTATTCAGTCTAGG - Intronic
1086849077 11:91787198-91787220 CTTATGTGTATACTCGGTCTGGG - Intergenic
1087055640 11:93933342-93933364 TTTCTGGGTTTACTAAGCATAGG + Intergenic
1091700804 12:2660394-2660416 TTTAGGGGTTTACTCACTGATGG - Intronic
1093648782 12:21619583-21619605 TTTAAGAGTTTACTAGGTCTAGG + Intergenic
1099873869 12:88381237-88381259 TTTATGTGTTTGCTCAGGCATGG - Intergenic
1100414016 12:94353003-94353025 TTTTTGGGTTGAATCAGTTTGGG - Intronic
1101907733 12:108840164-108840186 TTTGTGGGTGTAGTCAGTGTCGG - Intronic
1103143168 12:118569870-118569892 TTGATGTTTTTACTCAGTTTTGG + Intergenic
1103158973 12:118711680-118711702 TTTATGGCTTGACACAGTCAGGG + Intergenic
1110914914 13:81009354-81009376 TTTATTAAATTACTCAGTCTTGG + Intergenic
1111648744 13:91064015-91064037 TTGAGGGGTACACTCAGTCTTGG - Intergenic
1113305603 13:109075100-109075122 TATTTGGGTTTTCTCAGTTTTGG + Intronic
1113777939 13:112959434-112959456 TTTAGGGGTTTCCTCTCTCTGGG + Intronic
1120143124 14:80950761-80950783 TTTATGGTTTTCATCAGACTTGG - Intronic
1126788867 15:52202519-52202541 TTCATGTCTCTACTCAGTCTTGG + Intronic
1126900888 15:53313428-53313450 TTCATGGGATTACACAGTCGTGG + Intergenic
1127364084 15:58270715-58270737 TTTTTGTGTTTACTCATGCTAGG - Intronic
1127799558 15:62466159-62466181 TTAATGGTTGAACTCAGTCTAGG + Intronic
1128615679 15:69107087-69107109 TCTATGGGTTGACTGAGGCTGGG - Intergenic
1128804440 15:70520086-70520108 TCTATGGATTTGCTCACTCTGGG + Intergenic
1137328479 16:47465603-47465625 TTTATAGTTTTACTAAGTTTTGG - Intronic
1138900604 16:61264737-61264759 TTTGTGGGTTCAGTGAGTCTCGG + Intergenic
1140790463 16:78386305-78386327 TTTCTGGGTTTACTAAGCCAGGG + Intronic
1141748454 16:85942154-85942176 TTAATGGATTTAGTGAGTCTGGG - Intergenic
1144512531 17:15889591-15889613 TTTAGATGTTTACTCAGCCTAGG + Intergenic
1146442751 17:32911322-32911344 TTTCTGTGTTCTCTCAGTCTTGG - Intergenic
1146979436 17:37146243-37146265 TTTATGGCTATACTCCATCTTGG - Intronic
1148964782 17:51425740-51425762 TTCCTGGGTTTACTTACTCTTGG + Intergenic
1151514259 17:74581939-74581961 TTTCTGGGGGTACTCAGGCTGGG - Intronic
1157065007 18:44339299-44339321 TTTATGGGTTAACCCATTATGGG - Intergenic
1157239217 18:45993837-45993859 TTTATGAGTTTCCTCAGTGGTGG - Intronic
1157590041 18:48830988-48831010 TCTCTGGCTTTGCTCAGTCTAGG - Intronic
1158768086 18:60480094-60480116 TTTCAGTGTTTACTCACTCTTGG - Intergenic
1159380879 18:67657809-67657831 TTTCTTGGTTTACTTACTCTGGG - Intergenic
1159381669 18:67667598-67667620 TTATTGGGTTTATTCAGTCCTGG - Intergenic
1160056727 18:75489552-75489574 TTAATTAGTTGACTCAGTCTGGG + Intergenic
1162085016 19:8243428-8243450 TTCATGTGTCTACTCTGTCTGGG + Intronic
925775527 2:7331940-7331962 TTTATAAGTTTACCCAGTCTCGG - Intergenic
929263665 2:39894657-39894679 CCTGTGGGTTTACTCAGTGTTGG + Intergenic
930316717 2:49805416-49805438 TTTATTGGTTTAATCAGTTAAGG + Intergenic
931036283 2:58246519-58246541 AATTTGGGTTTACTAAGTCTAGG - Intergenic
933417012 2:81999115-81999137 TATATGTGTTTACTCTGTCTCGG + Intergenic
940178231 2:150903035-150903057 TTTATGGGTTGTCTCGGTCCAGG - Intergenic
940900567 2:159123007-159123029 TTTATGAGTTTAATCAGATTAGG - Intronic
943361786 2:186928231-186928253 TGTATAGGATTACTCAGTGTTGG + Intergenic
1170506738 20:17034412-17034434 CTTCTGGCTGTACTCAGTCTTGG + Intergenic
1172535125 20:35666795-35666817 TTTATAGGTTTGCTCTGTGTAGG + Intronic
1172878746 20:38183272-38183294 TTTATAGGTTTACTTATTCTGGG + Intergenic
1173740060 20:45394077-45394099 TTTTTGGGGTCACTCACTCTGGG - Intronic
1177611824 21:23459469-23459491 TTTCTGGGTTATCTTAGTCTTGG - Intergenic
1178378093 21:32084776-32084798 ATTATGGGTTCAGTCATTCTAGG + Intergenic
1179615634 21:42581510-42581532 GTTTTGGGTTTTCTCAGGCTTGG + Intergenic
1181488408 22:23245993-23246015 TTTATGGGTTTACGTATTGTGGG + Intronic
1181723698 22:24796122-24796144 TCTATGAGTTTACCTAGTCTGGG - Intergenic
1183172418 22:36198043-36198065 TTTGTGGGTTTACTAAGTTAAGG - Intronic
951191878 3:19781354-19781376 TTAAAGGGTTTACTGAGTTTTGG - Intergenic
951812695 3:26718115-26718137 TTTATCTGTTTACTCAGATTTGG + Intergenic
952471401 3:33656837-33656859 TTGCTGTGTTTACTCAGTATGGG - Intronic
952765188 3:36946972-36946994 TTTTTGGGTTTGTTCAGTTTGGG + Intergenic
954649097 3:52149406-52149428 GTTATGGGTTTCCTTACTCTTGG - Intronic
955951321 3:64245309-64245331 ATTATGGGGTTTCTCAGGCTGGG + Intronic
956831403 3:73052456-73052478 TATATGGGTTTACTCAAACCAGG + Intronic
956908040 3:73787275-73787297 TTTATGTGTTTATTCTGTCTTGG - Intergenic
959003137 3:100988392-100988414 TGTATGGTTTTTTTCAGTCTAGG + Intronic
960216611 3:115046415-115046437 TTGATGTGTTTACTCATTTTGGG - Intronic
964448771 3:156789104-156789126 TTTATCTATTTACTAAGTCTGGG - Intergenic
964871238 3:161315876-161315898 GTTCTTCGTTTACTCAGTCTTGG - Intergenic
968239293 3:197061669-197061691 TTTGTGTGTTTACTCACTCTCGG + Intronic
970026958 4:11633967-11633989 TATATGGGTAAACTCAGGCTTGG + Intergenic
971093430 4:23371601-23371623 TTTCTGGGTGTACTCCCTCTGGG - Intergenic
972286096 4:37649793-37649815 TTTATGTGTTTACTCTGTGCTGG - Intronic
972591287 4:40489942-40489964 TTTCTGGGTTAAATCAGACTTGG - Intronic
973177046 4:47220019-47220041 ATAATGGGTTTAATCAGTGTTGG - Intronic
973684121 4:53352519-53352541 CCTATGGGAATACTCAGTCTAGG + Intronic
975437303 4:74367703-74367725 TTTATGAGTTACCTGAGTCTTGG + Intronic
979143387 4:117207360-117207382 TATATGGATTTACTTATTCTAGG - Intergenic
982351303 4:154418249-154418271 TTCATGGGTTTTCTGAGCCTCGG - Intronic
987542210 5:19270498-19270520 TTTATTTCTGTACTCAGTCTGGG - Intergenic
988905303 5:35781985-35782007 TTAATGGGTTTCCTCAGGCAGGG - Intronic
993165661 5:84351601-84351623 TATATATGTTTACTCAGTATTGG + Intronic
994884628 5:105543868-105543890 TTTATGGGTTTTCTTAAACTGGG - Intergenic
994971987 5:106751696-106751718 TTTCTGGGTCTTCTCTGTCTAGG + Intergenic
996312769 5:122125606-122125628 TTTAAATGTTTACTCAGTCTGGG + Intergenic
997040213 5:130243987-130244009 TTTATGGGTGATCACAGTCTGGG - Intergenic
1001067025 5:168543617-168543639 TTTATGGTTTGACCCATTCTAGG - Intergenic
1002689144 5:181038201-181038223 TTTATGCATTTACTGGGTCTTGG + Intergenic
1003294300 6:4810460-4810482 TGTATGGGATGACTCAGTGTTGG + Intronic
1005180945 6:23106144-23106166 TTTAAGTGTTTAATCAGTCTTGG - Intergenic
1008150759 6:47948768-47948790 TCAATGGCTTCACTCAGTCTTGG + Intronic
1008600129 6:53085670-53085692 TTTATGAGTTTACATAGTTTTGG + Intronic
1008966994 6:57322669-57322691 TTTATGGGTTTACTCAGTCTTGG + Intronic
1009383358 6:63059875-63059897 TTTATGTGTTTGCTTTGTCTTGG + Intergenic
1009934219 6:70214391-70214413 TTTATGTGCTCAGTCAGTCTCGG + Intergenic
1011466631 6:87664641-87664663 TTTACTGGTTTACTCAGTTTAGG + Intronic
1012570404 6:100718972-100718994 TTAATAATTTTACTCAGTCTAGG + Intronic
1013425838 6:110011908-110011930 TTTGTAGATTTACTCAATCTTGG + Intergenic
1015223324 6:130829308-130829330 TTTATAGTTTTACTCATTCCTGG + Intronic
1015520691 6:134128212-134128234 TTCATGGATTTACTTATTCTGGG - Intergenic
1016068122 6:139704998-139705020 TTTCTTAGATTACTCAGTCTGGG + Intergenic
1016852495 6:148635465-148635487 TTGATGGATCTTCTCAGTCTGGG - Intergenic
1021348724 7:19561580-19561602 TTTATGCATTTACTCATTCATGG + Intergenic
1022024645 7:26435751-26435773 ATTATGGGTTTCCTCATTCTGGG + Intergenic
1022439398 7:30420636-30420658 TTCATGGGTTTAGCCAGGCTGGG + Intergenic
1023113650 7:36839280-36839302 TTTGTGGAATTACTCAGTTTTGG + Intergenic
1023386687 7:39664895-39664917 TTTATGGGTTTGCTTCTTCTAGG - Intronic
1023404270 7:39815257-39815279 TTTATGGGTATACCCAGTGTTGG + Intergenic
1027977149 7:85173368-85173390 ATTAAGGGTTTACTCTGTCCTGG + Intronic
1028265101 7:88714095-88714117 TTTATTGGTTTACTCTGTGTTGG - Intergenic
1028856673 7:95600789-95600811 TCTGTGCTTTTACTCAGTCTTGG - Intergenic
1029171256 7:98630495-98630517 TTTGTCGTTTTACTCTGTCTTGG + Intergenic
1029708906 7:102289059-102289081 TTTATGGCTATGCTCTGTCTAGG + Intronic
1031828167 7:126592077-126592099 TTTATGTGTTTATTCATTATTGG - Intronic
1032889314 7:136177458-136177480 TTTATGAATTTACTAACTCTTGG + Intergenic
1036665780 8:10736876-10736898 TTTATGGGAACACTCATTCTTGG - Intronic
1037057460 8:14459893-14459915 TTTATGGCTTGACTCATTTTAGG - Intronic
1037416250 8:18653089-18653111 ATTATGGGTCAACTAAGTCTTGG - Intronic
1038818739 8:30932680-30932702 TTCATGGGTTAACTCCTTCTGGG - Intergenic
1040505259 8:48041741-48041763 TTTAAGAGTTTATTCAGTTTAGG - Intronic
1041273042 8:56127617-56127639 TTTTTGGGTTTATTAAGTTTTGG - Intergenic
1041730220 8:61054862-61054884 TTGATTGGTTTATTCAGTGTGGG - Intergenic
1042731546 8:71940355-71940377 TTTATGTGTTAGCTCAGTTTGGG + Intronic
1042856983 8:73277576-73277598 TTTATGGGATTTATCTGTCTGGG - Intergenic
1044886711 8:96786227-96786249 TTTATGGATTTGCTTATTCTGGG + Intronic
1046344330 8:112902681-112902703 CTTATGGATTTACTGACTCTTGG + Intronic
1046368150 8:113264135-113264157 TTTATCAGTTTACTAAGTTTTGG + Intronic
1047633612 8:126735038-126735060 TTTAGGTGTTTAGTCAGTCTAGG + Intergenic
1058678066 9:107418109-107418131 TTTATGGATTTACCTATTCTGGG - Intergenic
1059479999 9:114581990-114582012 TTTATGGGTTTCCTTAGCCAAGG + Intergenic
1187196123 X:17086331-17086353 TTAATGGGTTTACGTAGTATTGG + Intronic
1187955270 X:24511545-24511567 TTTATAGGTTTAATAAGTGTTGG + Intronic
1188124255 X:26348302-26348324 TCTGTGGGTTTACTCATTCTGGG + Intergenic
1191767548 X:64714648-64714670 TTTTTGAGTTTACACAGTTTGGG - Intergenic
1193353321 X:80486722-80486744 TTTATGGTTGTATTCAGTTTGGG + Intergenic
1193638517 X:83983298-83983320 TTTATGTAATTACCCAGTCTTGG - Intergenic
1195124227 X:101789377-101789399 TTTATGTCTTTAATCAATCTGGG + Intergenic
1197446499 X:126556320-126556342 AGAATGGGTTTACTCTGTCTTGG - Intergenic
1198071246 X:133150623-133150645 TTTAGTGGTTTACTTGGTCTTGG - Intergenic
1199701774 X:150383810-150383832 TATATGGATTTACTTATTCTAGG + Intronic
1200474723 Y:3629736-3629758 TTTCTGGGTTTACTCTTCCTTGG + Intergenic