ID: 1008966995

View in Genome Browser
Species Human (GRCh38)
Location 6:57322670-57322692
Sequence TTATGGGTTTACTCAGTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 152}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008966989_1008966995 13 Left 1008966989 6:57322634-57322656 CCTGGGGAACTGTGAGTCAGTTA 0: 3
1: 71
2: 878
3: 2088
4: 2955
Right 1008966995 6:57322670-57322692 TTATGGGTTTACTCAGTCTTGGG 0: 1
1: 0
2: 0
3: 13
4: 152
1008966982_1008966995 30 Left 1008966982 6:57322617-57322639 CCTGAGGTCTCCCCAGCCCTGGG 0: 1
1: 18
2: 343
3: 2098
4: 5643
Right 1008966995 6:57322670-57322692 TTATGGGTTTACTCAGTCTTGGG 0: 1
1: 0
2: 0
3: 13
4: 152
1008966986_1008966995 19 Left 1008966986 6:57322628-57322650 CCCAGCCCTGGGGAACTGTGAGT 0: 7
1: 282
2: 4254
3: 9482
4: 9076
Right 1008966995 6:57322670-57322692 TTATGGGTTTACTCAGTCTTGGG 0: 1
1: 0
2: 0
3: 13
4: 152
1008966985_1008966995 20 Left 1008966985 6:57322627-57322649 CCCCAGCCCTGGGGAACTGTGAG 0: 7
1: 261
2: 4036
3: 9123
4: 9341
Right 1008966995 6:57322670-57322692 TTATGGGTTTACTCAGTCTTGGG 0: 1
1: 0
2: 0
3: 13
4: 152
1008966987_1008966995 18 Left 1008966987 6:57322629-57322651 CCAGCCCTGGGGAACTGTGAGTC 0: 5
1: 251
2: 3897
3: 9101
4: 8936
Right 1008966995 6:57322670-57322692 TTATGGGTTTACTCAGTCTTGGG 0: 1
1: 0
2: 0
3: 13
4: 152
1008966988_1008966995 14 Left 1008966988 6:57322633-57322655 CCCTGGGGAACTGTGAGTCAGTT 0: 5
1: 252
2: 2812
3: 7427
4: 7818
Right 1008966995 6:57322670-57322692 TTATGGGTTTACTCAGTCTTGGG 0: 1
1: 0
2: 0
3: 13
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008966995 Original CRISPR TTATGGGTTTACTCAGTCTT GGG Intronic
903502845 1:23811172-23811194 GTTTGGTTTTACCCAGTCTTTGG - Intronic
908289747 1:62652563-62652585 TTATGGGTTTACTGTGTGCTGGG - Intronic
909440057 1:75687115-75687137 ATCTGGGTTCAGTCAGTCTTAGG - Intergenic
911456472 1:98130501-98130523 TTGTTGTTTGACTCAGTCTTTGG - Intergenic
912349833 1:109001286-109001308 TTATTGATTTATTCATTCTTGGG - Intronic
914431948 1:147626648-147626670 TTATGGGTTTCCACAGTCCGTGG + Intergenic
916975104 1:170068054-170068076 TTGTAGGTTGACTCAGTGTTTGG - Intronic
917306619 1:173632296-173632318 TTATTGGTTTATTCAGGTTTTGG - Intronic
917570756 1:176263014-176263036 TTGTTGGTTACCTCAGTCTTGGG + Intergenic
918276080 1:182954724-182954746 TTATGGGTTTTTTAATTCTTAGG + Intergenic
919997856 1:202770273-202770295 TTAAGGGATTGCTCTGTCTTTGG - Intronic
921746631 1:218747907-218747929 TTATTGGTTTATTCAGGTTTTGG - Intergenic
1065118423 10:22504723-22504745 TGATGGGTCTGCTCTGTCTTGGG - Intergenic
1065507746 10:26446374-26446396 TCATGTGTTTACTCATTCTGTGG + Intronic
1073857837 10:107697696-107697718 TTTGTTGTTTACTCAGTCTTTGG - Intergenic
1073944625 10:108736056-108736078 TTATGCCTTTAATCAATCTTAGG + Intergenic
1074661684 10:115666355-115666377 TTATGCTTTTACTCTGTGTTTGG + Intronic
1075886322 10:125902360-125902382 TTTAGGGTTTACTCCGTGTTAGG - Intronic
1080769559 11:35327904-35327926 TTATGGGTATACTCTTTCTTGGG + Intronic
1080955886 11:37094939-37094961 TTATAAATTTACCCAGTCTTGGG + Intergenic
1083278863 11:61613190-61613212 TTTTGGGTTTCCTTTGTCTTGGG - Intergenic
1084987781 11:72892270-72892292 TTATGTGTCTACTAAGACTTGGG + Intronic
1085365673 11:75941217-75941239 TCTTGGGTTTACACAGACTTTGG - Intronic
1085994039 11:81889051-81889073 TTGTAGATTTACTCATTCTTAGG + Intergenic
1087031561 11:93710795-93710817 TTATTGGTCTACTCAGGTTTTGG + Intronic
1087537730 11:99471901-99471923 TTAAGTGTTTACTATGTCTTAGG - Intronic
1087642418 11:100769460-100769482 TTCTGGGTTTAGTCAGACTCTGG + Intronic
1088089334 11:106020006-106020028 TTGTGGGCTTACTATGTCTTAGG - Intronic
1088364599 11:109026524-109026546 TTATAGGTCTCTTCAGTCTTTGG + Intergenic
1091078099 11:132640190-132640212 TTGTGGGTTTGCTCAGGCTCCGG - Intronic
1093041968 12:14391689-14391711 TTATGTGTTCAGTAAGTCTTAGG + Intronic
1094005659 12:25747571-25747593 TTATGTGCTTACTGAGTATTAGG - Intergenic
1095389961 12:41694164-41694186 ATATGGGTTTGCTGAGTCTTAGG - Intergenic
1095860541 12:46912288-46912310 TTATTGGTTTGTTCAGGCTTTGG - Intergenic
1096015646 12:48271712-48271734 TTTTGCCTTTTCTCAGTCTTAGG + Intergenic
1100361399 12:93882926-93882948 TTAAGGGTACCCTCAGTCTTTGG + Intronic
1100512350 12:95288533-95288555 TTGTGAGGTTACTCAGACTTAGG + Intronic
1101192003 12:102343807-102343829 TTTTGTGTTTACTCCCTCTTGGG + Intergenic
1102778254 12:115540006-115540028 TTATGAGTTTACTGGATCTTGGG - Intergenic
1102929166 12:116849451-116849473 TTCTGGGTGTCCTCAGTGTTCGG - Exonic
1103147076 12:118604260-118604282 TTATGGGGTCACACAGTCCTGGG - Intergenic
1104212612 12:126704155-126704177 TGTTGGGTTTAATCAGCCTTTGG + Intergenic
1104585506 12:130045156-130045178 TAATGAGTTTACTCAGCCTTTGG + Intergenic
1107938220 13:45362871-45362893 TTATTGGCTTCCTCAGTGTTTGG + Intergenic
1107972487 13:45656993-45657015 TTATAGGGTTACTCAATCATTGG + Intergenic
1110074515 13:71222307-71222329 TTATTTTTTTAGTCAGTCTTGGG + Intergenic
1110131673 13:72019019-72019041 ATATGGGTTTACTCACTATCTGG - Intergenic
1110914915 13:81009355-81009377 TTATTAAATTACTCAGTCTTGGG + Intergenic
1111130716 13:83971985-83972007 TTATTGGTCTACTCAAGCTTTGG - Intergenic
1111446914 13:88358363-88358385 TTATTGGTATACTCAGGTTTTGG - Intergenic
1112225059 13:97531658-97531680 TTATGAGTCTACAGAGTCTTTGG - Intergenic
1113305604 13:109075101-109075123 ATTTGGGTTTTCTCAGTTTTGGG + Intronic
1113409307 13:110070351-110070373 TTATGGTTTTATTCCTTCTTAGG + Intergenic
1114513668 14:23283514-23283536 TTCTGTGTTTACACAGTCCTAGG + Intronic
1114628177 14:24142864-24142886 TTATGGGAATAATCAGGCTTTGG - Intergenic
1116276308 14:42837988-42838010 ATATAGGTTTAATCAGTCTCAGG + Intergenic
1116506293 14:45686234-45686256 TTATTGGTTTATTCAGGTTTTGG + Intergenic
1117691304 14:58310129-58310151 TCATGGGAATACTAAGTCTTAGG - Intronic
1118233073 14:63972327-63972349 TTATGGTTTTTCTCATTATTTGG - Intronic
1119950023 14:78735490-78735512 TTATGTGTGTGCTCAGACTTTGG + Intronic
1124786614 15:32687423-32687445 TTATGTGTTTACTTAAACTTAGG + Intronic
1125137631 15:36362609-36362631 TTCTGGGATTCCTCAGTCATCGG - Intergenic
1125246376 15:37646070-37646092 TTATTGAATTACCCAGTCTTAGG + Intergenic
1126788868 15:52202520-52202542 TCATGTCTCTACTCAGTCTTGGG + Intronic
1127639223 15:60899718-60899740 ATCTGGGTTTACTTAGTCGTTGG - Intronic
1128163762 15:65442558-65442580 TTATGGGTTTTCTCATTTTTAGG - Exonic
1130092869 15:80835728-80835750 TTAGGGGTTTCCTCTTTCTTAGG + Intronic
1130844384 15:87730927-87730949 TTGAGGGTTTATTCTGTCTTTGG + Intergenic
1131913020 15:97229579-97229601 TCATGGGTTTATTTGGTCTTTGG - Intergenic
1132376651 15:101332531-101332553 TCATGGGAAGACTCAGTCTTGGG + Intronic
1135886972 16:26319006-26319028 TTAAGTGTTTACTCAGTGTCAGG + Intergenic
1137232068 16:46575707-46575729 TCATGGGTTTGCTCAGCCTTCGG - Intergenic
1138906086 16:61335640-61335662 CTAAGGCTTTACTCAGTCCTTGG + Intergenic
1150810327 17:68351267-68351289 TTATGGACATACTCAGTATTTGG - Intronic
1156172271 18:34499914-34499936 TTTTGGGGTTACTTATTCTTTGG + Intronic
1156286001 18:35696551-35696573 TTACTGGTTTAGTCAGTTTTAGG + Intronic
1156771844 18:40737565-40737587 TTATTGGTTCACTCATTATTAGG - Intergenic
1157239216 18:45993836-45993858 TTATGAGTTTCCTCAGTGGTGGG - Intronic
1160301768 18:77687986-77688008 TTAAGTGTTTACTATGTCTTAGG - Intergenic
1162085299 19:8245248-8245270 TTATTGATTTACTCTGTTTTTGG + Intronic
925954724 2:8951876-8951898 TTTTGGTTTTATTGAGTCTTTGG + Intronic
929263666 2:39894658-39894680 CTGTGGGTTTACTCAGTGTTGGG + Intergenic
930324375 2:49896578-49896600 ATTTGGGTTTATTCATTCTTAGG - Intergenic
932391257 2:71392731-71392753 TAATTTGTTTACCCAGTCTTTGG - Intronic
940455464 2:153892845-153892867 TCATGGGTTTAATGAGTATTTGG - Intronic
940485280 2:154289238-154289260 TTATTGCTTTATGCAGTCTTGGG - Intronic
941144568 2:161828024-161828046 TCCTGGGTTTACTCTGACTTTGG + Intronic
943361787 2:186928232-186928254 GTATAGGATTACTCAGTGTTGGG + Intergenic
945162025 2:206901519-206901541 TTATTGGTCTATTCAGGCTTTGG + Intergenic
947906216 2:233765229-233765251 TAATGGGATTACTGAGTCTATGG - Intronic
1180016023 21:45084526-45084548 TTCTCTGTTTCCTCAGTCTTAGG + Intronic
1181715393 22:24723555-24723577 TTATAGGTTTTGTAAGTCTTAGG + Intronic
1182133527 22:27878355-27878377 TAATGGGCTTACTTACTCTTTGG - Intronic
1182681973 22:32086459-32086481 TTGTGGGTGTCCTCAGTTTTTGG + Intronic
949630953 3:5925807-5925829 TTATGTCATTACTGAGTCTTCGG - Intergenic
951191877 3:19781353-19781375 TAAAGGGTTTACTGAGTTTTGGG - Intergenic
952293185 3:32038090-32038112 GTATGGCTTTCCACAGTCTTAGG + Intronic
958254399 3:91308437-91308459 TTATAGCTTTCCTCAGTCTTTGG - Intergenic
962501545 3:135999182-135999204 TTGTGCATTTACTGAGTCTTAGG + Intronic
965885125 3:173436111-173436133 TGCTGGGTTCACTCAGTGTTTGG - Intronic
970799476 4:19955109-19955131 TTCTGGGTTTACACACTCTATGG + Intergenic
970891168 4:21046216-21046238 CTATGAGTTTCCTCATTCTTTGG - Intronic
973177045 4:47220018-47220040 TAATGGGTTTAATCAGTGTTGGG - Intronic
974677668 4:65115403-65115425 TTATTGGTCTATTCAGTTTTAGG - Intergenic
974769844 4:66397872-66397894 TTATTGGTTTATTCAGGTTTTGG + Intergenic
977185859 4:93935158-93935180 TTATGGGTCTGCTCAGATTTTGG - Intergenic
980413276 4:132451018-132451040 TTATTGGTCTATTCAGGCTTTGG - Intergenic
981866711 4:149429724-149429746 TTAAGGAGTTACTCAGTTTTAGG + Intergenic
982517981 4:156376150-156376172 TTATTGGTCTACTCAGGTTTTGG - Intergenic
983564214 4:169132503-169132525 TTCTGCGTTTAGTCATTCTTTGG - Intronic
987104836 5:14628092-14628114 TTCTGGATATACTCAGGCTTAGG - Intergenic
988137737 5:27196989-27197011 TTTTGAATTTACTCTGTCTTTGG + Intergenic
989998419 5:50862998-50863020 TTGTTGTTTTACTCAGTCTGTGG - Intergenic
993170949 5:84418353-84418375 TTATTGGTCTGCTCAGGCTTTGG + Intergenic
996298837 5:121957633-121957655 TTATTGGTTTATTCAGGTTTTGG + Intergenic
998222411 5:140296618-140296640 TTTTGCTTTTGCTCAGTCTTTGG - Intronic
1001735451 5:173994778-173994800 CTTAGGTTTTACTCAGTCTTGGG + Intronic
1005180944 6:23106143-23106165 TTAAGTGTTTAATCAGTCTTGGG - Intergenic
1005465365 6:26107642-26107664 TTATTGGTTTTAGCAGTCTTTGG + Exonic
1006462301 6:34168233-34168255 TTATTGGTTTATTCAGGTTTTGG + Intergenic
1007616001 6:43180101-43180123 TTCTGGGTTTGCCCAGTCCTGGG + Exonic
1008064132 6:47029474-47029496 TTAATGGTTTACAGAGTCTTTGG - Intronic
1008150760 6:47948769-47948791 CAATGGCTTCACTCAGTCTTGGG + Intronic
1008966995 6:57322670-57322692 TTATGGGTTTACTCAGTCTTGGG + Intronic
1009189433 6:60612049-60612071 TTATAGCTTTCCTAAGTCTTTGG + Intergenic
1010145417 6:72663431-72663453 TTTTTGGTGTACTCACTCTTAGG - Intronic
1010871808 6:81051978-81052000 TTTTTAGTTTACCCAGTCTTAGG - Intergenic
1011873880 6:91932114-91932136 TGATGTCCTTACTCAGTCTTTGG + Intergenic
1012392303 6:98756312-98756334 TTATGGCTTTTCTAAGTTTTAGG - Intergenic
1013398736 6:109770526-109770548 TTATGAAATTACTCAGTCTCAGG - Intronic
1013425839 6:110011909-110011931 TTGTAGATTTACTCAATCTTGGG + Intergenic
1017478464 6:154824530-154824552 TTTTTGCTTTACTCAGTCTGTGG + Intronic
1020338032 7:7079109-7079131 TTATAGGATTCCTCAGTGTTAGG + Intergenic
1021348725 7:19561581-19561603 TTATGCATTTACTCATTCATGGG + Intergenic
1022024646 7:26435752-26435774 TTATGGGTTTCCTCATTCTGGGG + Intergenic
1023404271 7:39815258-39815280 TTATGGGTATACCCAGTGTTGGG + Intergenic
1024120011 7:46227080-46227102 GTATTTGTTTTCTCAGTCTTTGG - Intergenic
1028265100 7:88714094-88714116 TTATTGGTTTACTCTGTGTTGGG - Intergenic
1029299883 7:99572724-99572746 TTATAGGATTTCTCAGTGTTAGG - Exonic
1033180242 7:139170169-139170191 TTATTGGTTTGCTCAGGTTTTGG - Intronic
1033882176 7:145898880-145898902 TTATTGGTTTGTTCAGGCTTTGG + Intergenic
1038712857 8:29964219-29964241 TTCTGGGTTTACACTGTCTCTGG + Intergenic
1040949196 8:52919150-52919172 TTCCTGGTTTACTCTGTCTTAGG - Intergenic
1041273041 8:56127616-56127638 TTTTGGGTTTATTAAGTTTTGGG - Intergenic
1044067485 8:87716874-87716896 TTATGTGATTACTCATGCTTAGG + Intergenic
1044077748 8:87844475-87844497 TTAGAGGTTTACACAGCCTTTGG + Intergenic
1045724365 8:105154730-105154752 TTTTGGATTTTCTCAGTGTTTGG + Intronic
1046190326 8:110786548-110786570 AAATGGCTTTTCTCAGTCTTGGG + Intergenic
1046368151 8:113264136-113264158 TTATCAGTTTACTAAGTTTTGGG + Intronic
1048296132 8:133215546-133215568 TTCTGGGTTCACACAATCTTTGG - Intronic
1051389574 9:16549503-16549525 TTATGGGGTTCCACAGCCTTCGG + Intronic
1058469186 9:105259302-105259324 TTATATGTTTAGTCAGTCTTTGG + Intronic
1188124256 X:26348303-26348325 CTGTGGGTTTACTCATTCTGGGG + Intergenic
1193781522 X:85708381-85708403 TTATTGGTTTGCTCAGGTTTTGG - Intergenic
1193957653 X:87882059-87882081 TTATGGGTTTATTCACGTTTTGG + Intergenic
1194971890 X:100352851-100352873 TTATGAAATTACCCAGTCTTAGG + Intronic
1195447580 X:104971806-104971828 TTCTGGTGTTCCTCAGTCTTAGG + Intronic
1195897020 X:109756227-109756249 TTATTGGTCTACTCAGGTTTTGG - Intergenic
1196145520 X:112312693-112312715 TTATGAATGTACTCTGTCTTTGG - Intergenic
1196361886 X:114870604-114870626 TTATGGGTTTGTTCAGGTTTTGG + Intronic
1196429749 X:115610771-115610793 TTATGGGTTTTCTGTGCCTTTGG + Intronic
1197540156 X:127749002-127749024 TTCTGAATTTTCTCAGTCTTTGG + Intergenic
1199048643 X:143208294-143208316 TTATTGGTCTACTGAGGCTTTGG - Intergenic
1199485450 X:148342446-148342468 TTATTGGTTTGCTCAGATTTTGG - Intergenic
1199655674 X:149992998-149993020 GTCTGGGTTTTCTCTGTCTTGGG + Intergenic
1200014791 X:153151636-153151658 TTATTTGTTCACTCATTCTTCGG - Intergenic