ID: 1008968681

View in Genome Browser
Species Human (GRCh38)
Location 6:57341205-57341227
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008968679_1008968681 4 Left 1008968679 6:57341178-57341200 CCTTCTTGTGTGACTATTTTGAT 0: 1
1: 0
2: 1
3: 16
4: 248
Right 1008968681 6:57341205-57341227 CTAGTTCAGTGATTCTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr