ID: 1008969586

View in Genome Browser
Species Human (GRCh38)
Location 6:57351494-57351516
Sequence CTGTGAGAATGGAAAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4218
Summary {0: 2, 1: 0, 2: 7, 3: 245, 4: 3964}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008969583_1008969586 18 Left 1008969583 6:57351453-57351475 CCAAATGAAGGACTGAATGAGGA 0: 1
1: 1
2: 0
3: 27
4: 258
Right 1008969586 6:57351494-57351516 CTGTGAGAATGGAAAGAAGTGGG 0: 2
1: 0
2: 7
3: 245
4: 3964

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008969586 Original CRISPR CTGTGAGAATGGAAAGAAGT GGG Intronic
Too many off-targets to display for this crispr