ID: 1008969586 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:57351494-57351516 |
| Sequence | CTGTGAGAATGGAAAGAAGT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 4218 | |||
| Summary | {0: 2, 1: 0, 2: 7, 3: 245, 4: 3964} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1008969583_1008969586 | 18 | Left | 1008969583 | 6:57351453-57351475 | CCAAATGAAGGACTGAATGAGGA | 0: 1 1: 1 2: 0 3: 27 4: 258 |
||
| Right | 1008969586 | 6:57351494-57351516 | CTGTGAGAATGGAAAGAAGTGGG | 0: 2 1: 0 2: 7 3: 245 4: 3964 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1008969586 | Original CRISPR | CTGTGAGAATGGAAAGAAGT GGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||