ID: 1008971103

View in Genome Browser
Species Human (GRCh38)
Location 6:57369168-57369190
Sequence CACAGTAAATAGAAGGGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 1, 2: 2, 3: 19, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008971103_1008971107 22 Left 1008971103 6:57369168-57369190 CCACTACCCTTCTATTTACTGTG 0: 1
1: 1
2: 2
3: 19
4: 186
Right 1008971107 6:57369213-57369235 CTGCTCCTTAATCTGCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008971103 Original CRISPR CACAGTAAATAGAAGGGTAG TGG (reversed) Intronic
906293525 1:44635266-44635288 CACTGCAAATAGAAAGGTATGGG + Intronic
909007560 1:70295019-70295041 ACCAGTAGATAGAAGGGGAGTGG - Intronic
910704698 1:90116227-90116249 CACAAAAAATAGAAAGGAAGTGG - Intergenic
910861820 1:91749491-91749513 CACAGAAATTAGAAGGCTAAAGG + Intronic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
916997163 1:170313378-170313400 CAAAGTAAATAAAAGGATAGAGG - Intergenic
919426552 1:197439538-197439560 CACATCAAATAGAAGAGCAGAGG - Intronic
920454283 1:206086431-206086453 CACAGCAATTAGAAAGGCAGGGG - Intronic
922810616 1:228413657-228413679 CACAGAACCTAGAAGGGTAGAGG + Intronic
923593636 1:235342872-235342894 AACAGTAAATAGGTGAGTAGGGG + Exonic
923820525 1:237435175-237435197 CACAGTGAAAATAAAGGTAGAGG + Intronic
924400414 1:243674499-243674521 TACAGTAAATACAGAGGTAGAGG + Intronic
1064071132 10:12229058-12229080 CACAGAAAGGAGAAGCGTAGAGG - Intronic
1065721513 10:28632363-28632385 CACAGTACTTTGAAGGGTTGAGG - Intergenic
1070131847 10:73661501-73661523 CAAAGTAGCTAGAAGGCTAGGGG + Intronic
1071433909 10:85628835-85628857 CAGAGTGAATAGAATGGGAGTGG + Intronic
1074332411 10:112528783-112528805 CAGAGGAAATAGAAAGGAAGGGG + Intronic
1075908039 10:126099419-126099441 CACTGTAAATATAAGTATAGTGG - Intronic
1076243050 10:128924915-128924937 CACATGAAATAGAAGTGTATTGG - Intergenic
1078427476 11:11263690-11263712 AACAGTAAATTGAAGGGAAATGG + Intergenic
1079934742 11:26602858-26602880 CACAGTAATTACATGGGTTGGGG - Intronic
1080682082 11:34486524-34486546 CAGAGTGAATAGAAGGGCATGGG + Intronic
1081598977 11:44479071-44479093 CACAGGAAATACAGGGATAGAGG - Intergenic
1082087756 11:48064190-48064212 CACAGTTAAAATGAGGGTAGAGG - Intronic
1083372530 11:62193281-62193303 CAAAGACAATTGAAGGGTAGAGG - Intronic
1083516508 11:63263652-63263674 AACAGTAAAAAGATGGGCAGAGG - Intronic
1086103143 11:83122452-83122474 CAAAGAAAATAGAAGGGCTGGGG - Intergenic
1086119918 11:83295041-83295063 CACGGTCAATTGAAGGGTATTGG - Intergenic
1087526935 11:99326753-99326775 CAAAGTATAAAGAAGGGAAGGGG + Intronic
1088170978 11:106996241-106996263 CATAGGAAAAAGAAGGGGAGGGG + Intronic
1089638170 11:119829887-119829909 CCCAGTAAGTAGATGGGCAGGGG - Intergenic
1091261309 11:134236773-134236795 GACAGAAAATAGAATGGTAGAGG + Intronic
1093205486 12:16243709-16243731 CACAGTTAATAGTAGTGTAAGGG - Intronic
1093376456 12:18433855-18433877 CACAGTAAGCAGTAGGGTACAGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097437453 12:59568898-59568920 CAGAGAAAATAGAAGAGTCGAGG - Intergenic
1097696742 12:62781932-62781954 CACACTAAAAAGATGGGGAGGGG + Intronic
1098575792 12:72040745-72040767 CTCAGTAAATAGTAGGTTTGAGG + Intronic
1100304888 12:93341256-93341278 CACTCTAATTAGTAGGGTAGCGG - Intergenic
1100635906 12:96434238-96434260 AACACTAAAGAGAAGGGCAGAGG + Intergenic
1102327721 12:112002602-112002624 CACAGTAAATAGAAGAGCAGGGG - Intronic
1103282789 12:119774113-119774135 AACAGAAAGTAGAAAGGTAGGGG + Intronic
1104304498 12:127597174-127597196 CACAGAAAACATAAAGGTAGAGG - Intergenic
1106005267 13:25763842-25763864 CACAGTAGACAGAAGGGATGTGG + Intronic
1106397163 13:29392247-29392269 GACAGAAAATAGAATGGTGGTGG - Intronic
1106727467 13:32500811-32500833 CTCAGTAGACAGAAGGGAAGAGG - Intronic
1106980000 13:35268314-35268336 GACAGAAAATAGAATGGTGGTGG + Intronic
1108757579 13:53522605-53522627 CACAGAAAATACATGGGCAGAGG + Intergenic
1110219014 13:73053198-73053220 CAGAGTAAAAATAAGTGTAGAGG + Intergenic
1112343177 13:98568952-98568974 CACAGAAAATGGAAGGGGGGAGG + Intronic
1116731360 14:48626237-48626259 CACAGTATAAGGAAGGGAAGGGG + Intergenic
1117803629 14:59468341-59468363 CACAGAAAAAAGAAGGAAAGTGG - Intronic
1117946388 14:61027796-61027818 CATAGTGAATAGAATGGTGGTGG + Intronic
1118354690 14:65003438-65003460 CCCAGAAATTAGAAGGGTAGAGG - Intronic
1120774229 14:88415368-88415390 AACAGTAAATAGAAGAGCAGGGG - Intronic
1121563424 14:94891560-94891582 CACAATAAATAGGTGGGTGGTGG - Intergenic
1122329017 14:100900580-100900602 CACAGCAAAAAGGAGTGTAGGGG + Intergenic
1122918992 14:104871868-104871890 CACAGCAGGTAGACGGGTAGGGG + Intronic
1124384107 15:29192012-29192034 CACAGTAATTGGCAGAGTAGAGG - Intronic
1124420956 15:29521466-29521488 CACTGTAAAAATAAGGATAGAGG + Intronic
1127286970 15:57541027-57541049 CACAGTACCCTGAAGGGTAGAGG + Intronic
1127357638 15:58216126-58216148 CACAGAAAATATAGGGATAGAGG - Intronic
1128134746 15:65254541-65254563 CACAGTAGAGAGGAGGGGAGCGG + Intronic
1128691459 15:69727472-69727494 GACAGTACAAAGAAGGGTTGTGG + Intergenic
1130725363 15:86433305-86433327 CATAGTTAATGGATGGGTAGAGG + Intronic
1135038489 16:19098416-19098438 CACAGTGAGCAGAGGGGTAGTGG + Intergenic
1136154431 16:28373742-28373764 CTCAGTCAAGAGAAGGGTGGGGG - Intergenic
1146118927 17:30172104-30172126 CAGAGAAAATAGAATGGTACAGG - Intronic
1148465875 17:47865012-47865034 TGCAGTAATTAGAAGGGGAGAGG + Intergenic
1150253561 17:63724794-63724816 CACAGTAAAGGAAAGGATAGTGG - Intronic
1150565430 17:66335071-66335093 GACAGAAAGTAGAATGGTAGTGG + Intronic
1157683125 18:49622393-49622415 AAAAATAAATAGAAAGGTAGAGG - Intergenic
1158308446 18:56132608-56132630 TACAGTAAATAGCATGGTACTGG + Intergenic
1158641792 18:59209937-59209959 CACAGTAAATGGCAGAGAAGGGG + Intergenic
1159705973 18:71688192-71688214 CACAGCAAAGAGAAGGGGAAAGG + Intergenic
1165558737 19:36659717-36659739 CACAGTAAATATACAGGGAGAGG - Intronic
1167228609 19:48267160-48267182 CAGAGAAAATAGAAGGGAATTGG + Intronic
926188740 2:10711577-10711599 CACCATAAAAAGAAGGGTAAAGG + Intergenic
928873333 2:36007438-36007460 CACACTAAATATAAAGGTAGAGG + Intergenic
929240151 2:39646112-39646134 CACAGTTAATTGAAGGGTGGTGG - Intergenic
929721661 2:44375537-44375559 CACACTTAATAGAAGTTTAGAGG + Intronic
939758542 2:146144787-146144809 AACAGTAAAGAGAAGAGCAGAGG - Intergenic
941765826 2:169295223-169295245 CACAGTAAATAGCTGCTTAGTGG - Intronic
942650325 2:178160166-178160188 AACAGAAAGTAGAAGGGTAGTGG - Intergenic
944956493 2:204817454-204817476 CAGAGTACACAGAAGGGTATTGG - Intronic
945587932 2:211690343-211690365 TACAGTAAGTGGAAGGGTAAAGG + Intronic
945612303 2:212019104-212019126 AGCAGCAAAGAGAAGGGTAGAGG + Intronic
945692973 2:213064957-213064979 CACATTAAATACAAAGGTATTGG + Intronic
947074854 2:226331520-226331542 AGCAGTAAGTAGAAGGGTGGGGG + Intergenic
947613959 2:231542663-231542685 GACAGAAAGTAGAATGGTAGTGG + Intergenic
948077919 2:235180967-235180989 GACAGAAAATAGAAAGGTAATGG + Intergenic
948125184 2:235559539-235559561 CACAGGAAATAGAAAGCTAAAGG + Intronic
948720462 2:239896424-239896446 GACAGGAAATTCAAGGGTAGAGG + Intronic
1169870235 20:10241382-10241404 CTCAGTAAATACATGGGGAGTGG - Intronic
1170483801 20:16794600-16794622 CCAAGTAAATACAGGGGTAGAGG - Intergenic
1171993704 20:31716220-31716242 CAAAGGACCTAGAAGGGTAGAGG + Intronic
1173410550 20:42805842-42805864 CACAGTATTTAGAAGGGAATAGG - Intronic
1173507319 20:43598257-43598279 GACAGAAAATAGAAGGGTGGTGG + Intronic
1174746769 20:53071566-53071588 CATAGTAAATAGAAAAGAAGAGG - Intronic
1174846414 20:53947732-53947754 CACGGTAAATGGAGGGGTTGGGG - Intronic
1176520648 21:7821668-7821690 CACAGTTCAGAGATGGGTAGAGG - Intronic
1176529798 21:7949274-7949296 CAGAGTGAATAGGAGTGTAGTGG - Intergenic
1177839575 21:26220651-26220673 CACAGAAACTAAGAGGGTAGAGG + Intergenic
1178489166 21:33037005-33037027 CACAGAAAGTAGATTGGTAGGGG - Intergenic
1178990747 21:37353978-37354000 CACGTTAAATATAAAGGTAGGGG + Intergenic
1179084768 21:38207054-38207076 CACAGGACATAGAGGGGCAGTGG + Intronic
1181675670 22:24450061-24450083 CACAGTGAGGAGCAGGGTAGTGG - Intergenic
1182138515 22:27930919-27930941 CACAATAAAAAGAAGGGCAGGGG - Intergenic
951486340 3:23215701-23215723 AACAGCAAAGAGAAGGGTGGTGG - Intronic
952912613 3:38203828-38203850 CACAGGCAATAGCTGGGTAGTGG - Intronic
953552784 3:43917411-43917433 AACAGCATATAGAAGGGTGGGGG - Intergenic
954954274 3:54505457-54505479 CAAAGTAAAGAGTAGGGTAGAGG - Intronic
957635386 3:82777385-82777407 TACAGTAAACATAAGAGTAGAGG - Intergenic
958832230 3:99103397-99103419 CATAGTAAATAAAAGGGAGGTGG + Intergenic
958917387 3:100064836-100064858 CACAGTAAAAAGATTGGTAGAGG + Intronic
960254811 3:115500738-115500760 CACAGAAAATAGAAAGAAAGAGG + Intergenic
961862508 3:129927883-129927905 CATAGCAAATAGAAGACTAGAGG - Intergenic
962932443 3:140050750-140050772 CACAGAAGAGAGAAGGGTAGTGG + Intronic
963755540 3:149231752-149231774 TACAGGAAAGAGAAGGGGAGAGG + Intergenic
964280562 3:155060019-155060041 AACAGTAACAATAAGGGTAGAGG + Intronic
964305713 3:155337327-155337349 CACAGTAAATATAAATATAGTGG - Intergenic
969230934 4:5830523-5830545 GATAGTAAATAGTAGGGCAGAGG + Intronic
971013110 4:22460752-22460774 CTGAGAAATTAGAAGGGTAGAGG + Intronic
973015917 4:45136674-45136696 CTAAGTAAATAGATGGGCAGTGG + Intergenic
974005662 4:56553867-56553889 GACAGTAAATAGATCAGTAGTGG - Intronic
974782124 4:66565799-66565821 TTCAGTAAAGAGAAGGATAGGGG + Intergenic
975007607 4:69310269-69310291 CACTGTAAATAGAAAAGTAGAGG + Intronic
975351696 4:73354512-73354534 CATAGAAAATAGGAGGGTAATGG + Intergenic
977492007 4:97726260-97726282 GACAGAAAATAGAATGGTAGTGG + Intronic
977654253 4:99503798-99503820 CCCAGTAAATAAAATGGTGGGGG - Intergenic
978081103 4:104592734-104592756 CAGGGTAAATAGCAGGGAAGTGG + Intergenic
978485381 4:109247627-109247649 AACAGTAAATAGATAGATAGAGG + Intronic
979777605 4:124610554-124610576 CACAGTCAGTGGAGGGGTAGAGG - Intergenic
985175938 4:187201251-187201273 CACAGTAAATAATGGGGTAAGGG - Intergenic
986574669 5:9199344-9199366 CACAGCAAGTGAAAGGGTAGAGG - Intronic
987161363 5:15147191-15147213 CAAAGTAAAAAGCAGTGTAGAGG + Intergenic
989199502 5:38749829-38749851 GACAGTAACTAGAAGGGGAAAGG - Intergenic
992166181 5:74054198-74054220 CACAGAAAATAAAGGGGCAGTGG - Intergenic
993864513 5:93176257-93176279 CAGAGTAGACAGAAGGGTTGGGG - Intergenic
994981738 5:106883711-106883733 CATATTAAATACTAGGGTAGGGG + Intergenic
995202136 5:109437914-109437936 CAAAATAAATAAAAGGGTATTGG + Intergenic
996382898 5:122880075-122880097 CAAAGTAAACAGAAGGTTGGAGG - Intronic
996619008 5:125477690-125477712 CCCAGTAAAAATAAGGGTATTGG + Intergenic
997866449 5:137467799-137467821 CTCAGCAAATGGAAGGGTGGAGG + Intronic
999208733 5:149869462-149869484 AACAGAAAATAGAAAGGGAGGGG + Intronic
1002939792 6:1705896-1705918 CACAGCAATGAGAAGGGTGGCGG + Intronic
1004720678 6:18265148-18265170 CCCTGTAAATATAAGGGGAGAGG + Intergenic
1006745507 6:36339207-36339229 CACAATAAAAAGAAGGGGAGGGG + Intergenic
1008971103 6:57369168-57369190 CACAGTAAATAGAAGGGTAGTGG - Intronic
1009160064 6:60270987-60271009 CACAGTAAATAGAAGGGTAATGG - Intergenic
1009793952 6:68441972-68441994 CATAGTAAATAGAACTTTAGTGG + Intergenic
1010098763 6:72078006-72078028 CATAGTAAACAAAAGCGTAGAGG - Intronic
1011063913 6:83302887-83302909 AACAGTCAATAGCAGGGTAAAGG + Intronic
1011319230 6:86071727-86071749 CACAATGAATAGAAGAGGAGGGG + Intergenic
1014047245 6:116904695-116904717 GACAGAAAGTAGAATGGTAGTGG - Intronic
1014657443 6:124126071-124126093 GACAGAAAATTGAAGGGCAGTGG - Intronic
1016627514 6:146189759-146189781 CACAGCAGATAGAATCGTAGTGG - Intronic
1017598465 6:156055615-156055637 TAAAGTAAGTATAAGGGTAGGGG - Intergenic
1021348703 7:19561224-19561246 CACAATAAATAAATGGGTGGAGG - Intergenic
1023475983 7:40578391-40578413 CCCATTAAATAGAAGGCAAGGGG - Intronic
1023597514 7:41847163-41847185 AACAATAAATAGGAGGGTGGAGG - Intergenic
1025035270 7:55589713-55589735 CACAGAAAAGAGAAGGGTGAGGG - Intergenic
1025216018 7:57057350-57057372 TCTAGTAAAGAGAAGGGTAGAGG + Intergenic
1025626757 7:63229751-63229773 TCTAGTAAAGAGAAGGGTAGAGG + Intergenic
1025655361 7:63513354-63513376 TCTAGTAAAGAGAAGGGTAGAGG - Intergenic
1028129034 7:87148304-87148326 TACAGTGAATAGAAGGGAAGGGG + Intergenic
1028885352 7:95926753-95926775 GACAGTTAATAGACAGGTAGAGG - Intronic
1030764706 7:113394912-113394934 CACAGGAAACAGGAGGGTCGGGG + Intergenic
1032760268 7:134933998-134934020 AACAGAAAATAGAAGGGAAATGG + Exonic
1033550739 7:142445355-142445377 CACTGTCCAGAGAAGGGTAGGGG + Intergenic
1033799158 7:144880264-144880286 CACAGTGAATACAGGGGTTGTGG + Intergenic
1038117692 8:24576229-24576251 CAGGGTAAAGGGAAGGGTAGTGG - Intergenic
1043270180 8:78323262-78323284 CACAGTGAATAGAATGGAAAAGG + Intergenic
1044371157 8:91412598-91412620 CACAGCCAATAGGAGAGTAGAGG + Intergenic
1045288848 8:100814583-100814605 CACACTAAGTAGAAGGTTATAGG - Intergenic
1045614767 8:103896943-103896965 CACAGAAAATACAAGGAGAGGGG + Intronic
1047978883 8:130159318-130159340 TGCAGTGAATAAAAGGGTAGAGG + Intronic
1048178372 8:132172814-132172836 CACTGTACAAAGAAGGGAAGGGG + Intronic
1048606804 8:135977166-135977188 CTCAGAAAATAGAAGGGGGGAGG + Intergenic
1051745827 9:20293745-20293767 AACAGAAAATAGAAGGGTTGGGG - Intergenic
1052038397 9:23709162-23709184 AACAGTAAATAAAGGGATAGGGG - Intronic
1053476601 9:38386421-38386443 CACTGTAAAAAGAGGGGTATAGG - Intergenic
1055316567 9:75039886-75039908 TACAGGAAAGAGAAGGGGAGGGG - Intergenic
1055449179 9:76415544-76415566 CAAAGAACCTAGAAGGGTAGAGG + Intergenic
1056235057 9:84586252-84586274 CGCAGGAATTAGGAGGGTAGAGG + Intergenic
1057218242 9:93241554-93241576 CTCAGTAAAAAGAAGTGGAGGGG + Intronic
1058532467 9:105920292-105920314 CACAGTAAATAATAGGTTAATGG - Intergenic
1060871196 9:127041668-127041690 TACAGTGACTAGAAGAGTAGGGG + Intronic
1203387270 Un_KI270438v1:67143-67165 CAGAGTGAATAGGAGTGTAGTGG + Intergenic
1186002531 X:5029089-5029111 CAAAGAACATAGAAGGGTATAGG + Intergenic
1186209495 X:7234477-7234499 CAGAGCAAATAAAAGGGTGGTGG + Intronic
1188779950 X:34269590-34269612 CAGAGTAAAGAGAAAGGTAAAGG + Intergenic
1189172499 X:38923478-38923500 CTCAGTAAATAGTTGTGTAGTGG - Intergenic
1191889446 X:65925566-65925588 CATAGAATATAGATGGGTAGGGG + Intergenic
1192634333 X:72803698-72803720 CACAGAAAATAGATGGGCATAGG - Intronic
1192647377 X:72917103-72917125 CACAGAAAATAGATGGGCATAGG + Intronic
1192908464 X:75578315-75578337 CACAGGAAATAGAAAGGGAGGGG - Intergenic
1194478048 X:94384136-94384158 AATAGTAAATATAAGGGTAAGGG + Intergenic
1194601190 X:95923757-95923779 CACAGAAAATATAGAGGTAGAGG + Intergenic
1194927011 X:99837038-99837060 CAGAGTGAATACAGGGGTAGAGG - Intergenic
1197799018 X:130329550-130329572 CACAGTACATTAAAGGGGAGGGG - Intergenic
1198154658 X:133946914-133946936 CACAGTCAATAGAAGGGAAGGGG + Intronic
1199633956 X:149797449-149797471 CAGAGAAAATAGAAGAGAAGGGG - Intergenic
1200361709 X:155613189-155613211 TACCATAAATAGAAGCGTAGTGG - Intronic
1202101232 Y:21310105-21310127 CACAGAAAAGAGGTGGGTAGGGG + Intergenic
1202187109 Y:22197263-22197285 CACAGAAAAGAGGTGGGTAGGGG + Intergenic
1202204251 Y:22389133-22389155 CACAGAAAAGAGGTGGGTAGGGG - Intronic