ID: 1008973908

View in Genome Browser
Species Human (GRCh38)
Location 6:57402014-57402036
Sequence CTGGTTTGATATATCTGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008973902_1008973908 14 Left 1008973902 6:57401977-57401999 CCCTGGTTGCTCTGTCCAGGGAG 0: 1
1: 1
2: 32
3: 73
4: 233
Right 1008973908 6:57402014-57402036 CTGGTTTGATATATCTGGCAGGG No data
1008973901_1008973908 15 Left 1008973901 6:57401976-57401998 CCCCTGGTTGCTCTGTCCAGGGA 0: 1
1: 0
2: 37
3: 99
4: 386
Right 1008973908 6:57402014-57402036 CTGGTTTGATATATCTGGCAGGG No data
1008973903_1008973908 13 Left 1008973903 6:57401978-57402000 CCTGGTTGCTCTGTCCAGGGAGT 0: 1
1: 1
2: 41
3: 82
4: 324
Right 1008973908 6:57402014-57402036 CTGGTTTGATATATCTGGCAGGG No data
1008973904_1008973908 -1 Left 1008973904 6:57401992-57402014 CCAGGGAGTTGCAGAGCTGCTAC 0: 12
1: 30
2: 56
3: 132
4: 311
Right 1008973908 6:57402014-57402036 CTGGTTTGATATATCTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008973908 Original CRISPR CTGGTTTGATATATCTGGCA GGG Intronic
No off target data available for this crispr