ID: 1008974337

View in Genome Browser
Species Human (GRCh38)
Location 6:57407205-57407227
Sequence TGCCCCGCCAAAATCCAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 1, 2: 1, 3: 6, 4: 88}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008974337 Original CRISPR TGCCCCGCCAAAATCCAAAA AGG (reversed) Intronic
909250508 1:73347776-73347798 TGGCCAGCCAGAATACAAAAAGG - Intergenic
911179825 1:94850439-94850461 CTCCCTGCCAAAATCCAATATGG - Intronic
916322642 1:163522026-163522048 TGCCCCACCAGAATTCAAAGAGG - Intergenic
916490560 1:165298537-165298559 TTAGCCGCCAAAATCCAGAATGG - Intronic
917228812 1:172813993-172814015 TGCAAATCCAAAATCCAAAAGGG + Intergenic
918141646 1:181724912-181724934 TCTCCCACCAAAACCCAAAAGGG - Intronic
1063313443 10:4978525-4978547 TGCCCCACCACAAACCAATAGGG - Exonic
1063314509 10:4989192-4989214 TGCCCCACCACAAACCAATAGGG + Exonic
1064403176 10:15038107-15038129 TGCCAGTCCAAAATCCAACAGGG - Intronic
1064690135 10:17908477-17908499 AGACCCGCCAAATTCTAAAATGG - Intronic
1066480771 10:35793781-35793803 TGCCTGGCCAAAATTTAAAATGG - Intergenic
1067150760 10:43731128-43731150 TGCCCCCCCACAATGCTAAAGGG + Intergenic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1072423427 10:95308951-95308973 TGCCTGGCCAAAAGCCACAAAGG + Intergenic
1078610643 11:12816301-12816323 TGCTCCTCCAAAATCCTACAGGG - Intronic
1082601855 11:55168099-55168121 TGCCACGCCAACTTCCAAAATGG + Intergenic
1084632441 11:70362467-70362489 TGCCCCGCCCACATCTAGAACGG + Exonic
1086834071 11:91600080-91600102 TTCGCCTCCAAAATCCAAATAGG - Intergenic
1090837995 11:130467251-130467273 TGCCCCCTCAAAAGCCACAATGG - Intronic
1091801783 12:3328965-3328987 TGCCCCTCCAAAAATAAAAACGG - Intergenic
1091919807 12:4295085-4295107 TGCCCTTCCCAAGTCCAAAAAGG + Intronic
1095253106 12:40001217-40001239 TGCATTGCCAAAATCCAAACTGG + Intronic
1100674805 12:96855557-96855579 TGCAAGTCCAAAATCCAAAAGGG + Intronic
1102775115 12:115511995-115512017 TGCCCCTACAAAATCCAGCATGG + Intergenic
1105481647 13:20783602-20783624 AGGCTCTCCAAAATCCAAAATGG + Exonic
1108326090 13:49333185-49333207 TGACCAGCCAACATCCAACAGGG - Intronic
1109278681 13:60330765-60330787 TTCCTCGCCAAACTCCAAAGGGG + Intergenic
1109480343 13:62944755-62944777 TGCCAGTCCAAAATCCAGAAGGG + Intergenic
1110061307 13:71041294-71041316 TGCACTGCCAAATTCCAAAGAGG + Intergenic
1111540057 13:89657783-89657805 TGCCCTTCCACAATCCAAACTGG + Intergenic
1112996007 13:105575709-105575731 TGCCAGTCCAAAATCCAATAGGG - Intergenic
1114922036 14:27343837-27343859 TGCAACTCCAAAATCCAACAGGG - Intergenic
1120620097 14:86752522-86752544 TGCCACTCCTAAATCCAATAGGG + Intergenic
1126210218 15:46093213-46093235 TGCCCCACCAATAGCCAAAGGGG - Intergenic
1127276665 15:57451834-57451856 TGGCCTGCCTAAATCCAACAGGG - Intronic
1130853270 15:87818997-87819019 TGCCCTTCCAAATTCCCAAAAGG + Intergenic
1135120701 16:19764028-19764050 TGACCAGCCAAAATCCAAAGAGG + Exonic
1136678396 16:31937362-31937384 TGCCCTGCAAAAATGCTAAAAGG + Intergenic
1139168063 16:64594535-64594557 GGCACTGCCACAATCCAAAAAGG - Intergenic
1141630186 16:85283412-85283434 TGCAGCCCCAAAGTCCAAAAAGG - Intergenic
1155142759 18:23057829-23057851 TGCCCTCACATAATCCAAAACGG + Intergenic
1165409277 19:35648831-35648853 GGCCCCTCCAACGTCCAAAAGGG - Intronic
1167840880 19:52118561-52118583 TGCCATGCCAAGAACCAAAATGG + Intronic
929518308 2:42624519-42624541 AGCCTGGCCAAAATGCAAAATGG - Intronic
933123760 2:78576756-78576778 TGCCAGGCCAGAATCCCAAAAGG + Intergenic
935387043 2:102510732-102510754 TGCCCCTCCTATATTCAAAAAGG - Intronic
936591557 2:113809266-113809288 TGCTTTGTCAAAATCCAAAAAGG - Intergenic
937905680 2:127051719-127051741 TGCGCAGCCCAAATCCAAGAAGG + Intronic
939629936 2:144517959-144517981 TGCCTCGATAAACTCCAAAAGGG - Intronic
940624122 2:156150845-156150867 TGCTAAGCCAAAATCCAAGAAGG + Intergenic
941010063 2:160289300-160289322 TTCCCCGCTAAAAGCAAAAAGGG + Intronic
941525023 2:166596763-166596785 TGCAAGGCCAAAATCCAATAGGG + Intergenic
942869982 2:180722832-180722854 TGCTCTGCCAAAAGCAAAAATGG + Intergenic
943271767 2:185814331-185814353 TTACCAGCCAAAATACAAAAGGG - Intronic
943968850 2:194376265-194376287 TTCCCCACAAAAAGCCAAAACGG + Intergenic
946830296 2:223721932-223721954 TGCCCAGCCATCATCCAAAGAGG + Intergenic
946873587 2:224106773-224106795 GGCCCCTCCTACATCCAAAAAGG - Intergenic
947110288 2:226710902-226710924 GGCCTCGCCAAAATCCAAAAAGG + Intergenic
1169214016 20:3783528-3783550 TGCCCCTCCAAACTCCAATCTGG + Intergenic
1169361195 20:4950712-4950734 TGCCCTTCCCAAATCCAGAAAGG + Intronic
1184206281 22:43005775-43005797 TGCCCCGCCAAAATCCTATGAGG + Intronic
950090876 3:10293251-10293273 AGCCCCACCAAGTTCCAAAAAGG - Intronic
950133929 3:10567223-10567245 TGGCCCCCTAAATTCCAAAAGGG - Intronic
955045066 3:55351963-55351985 ACCCCAGCCAAGATCCAAAAAGG - Intergenic
959893592 3:111583168-111583190 TGCAAGTCCAAAATCCAAAAGGG + Intronic
962035101 3:131643341-131643363 TGCAAGTCCAAAATCCAAAAGGG - Intronic
963062519 3:141235904-141235926 TCCCCAGCCAAAGTCCAAAAAGG - Intronic
967311686 3:188112047-188112069 TGCCCAGCCAAAATCCAGTATGG - Intergenic
975541794 4:75520266-75520288 TGCCCCGGCAACCTACAAAATGG - Intronic
976599782 4:86927597-86927619 AGCCTGGCCAAAATGCAAAATGG + Intronic
978854408 4:113377449-113377471 TACCTTGCTAAAATCCAAAAGGG + Intronic
980280015 4:130707069-130707091 TGCAACTCCAAAATCCAATAGGG + Intergenic
986533457 5:8762260-8762282 TGCAAGTCCAAAATCCAAAAGGG - Intergenic
1006890491 6:37423329-37423351 TACTCCCCCAAAATACAAAAAGG - Intergenic
1008974337 6:57407205-57407227 TGCCCCGCCAAAATCCAAAAAGG - Intronic
1009163226 6:60308718-60308740 TGCCCCGCCAAAATCCAAAGAGG - Intergenic
1009613811 6:65979812-65979834 TGCCTATCTAAAATCCAAAAGGG - Intergenic
1009804866 6:68590276-68590298 TGCAACTCCAAAATCCAATAGGG + Intergenic
1010368888 6:75084757-75084779 TTCCCCTCCTAAAACCAAAAAGG - Exonic
1015487606 6:133790128-133790150 TGCAAGCCCAAAATCCAAAAAGG + Intergenic
1016721625 6:147304809-147304831 TGCAAATCCAAAATCCAAAAGGG - Intronic
1019089072 6:169510202-169510224 TGCCACGCCAACTTCCACAATGG - Intronic
1021626050 7:22594240-22594262 TGCCCAGCCAAAAACAAATAGGG + Intronic
1022872336 7:34492547-34492569 TGCCCTTCCAGAATCCAACATGG - Intergenic
1027611213 7:80363183-80363205 TGCCCCCCCAAAATCTAGATAGG - Intergenic
1034735645 7:153426889-153426911 TGCCCTGTCAAAATAAAAAAGGG - Intergenic
1035551500 8:531047-531069 TGACCCCCCAAAATTCAGAATGG + Intronic
1038378849 8:27072923-27072945 TGCTGCTCCAAAATCCACAAGGG - Intergenic
1043173495 8:76995334-76995356 TGCCTCATCAAAATCCAAATAGG + Intronic
1047255274 8:123209175-123209197 TTCCCCGCCAAAAACCGACAAGG - Exonic
1047274711 8:123396720-123396742 TCCCGCGCCAAAATTCCAAACGG - Intronic
1049864620 8:144926101-144926123 TCCCCAGTCAAAATCCAAATAGG - Intergenic
1050724550 9:8633047-8633069 TGCTCTGCCAAAAATCAAAATGG + Intronic
1057300413 9:93875997-93876019 TGCCCTGCAAAAGTACAAAAAGG + Intergenic
1186104167 X:6187761-6187783 TTCCCCTCCAAAATCCTACAAGG - Intronic
1196199029 X:112864619-112864641 TCCCCCTCCAACATCCAAACTGG - Intergenic
1199655668 X:149992953-149992975 TGCCTCAGCAAAATCCAAAATGG - Intergenic