ID: 1008975188

View in Genome Browser
Species Human (GRCh38)
Location 6:57417942-57417964
Sequence TTGATTAGCGAGGATCTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 1, 2: 1, 3: 2, 4: 62}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008975188_1008975190 14 Left 1008975188 6:57417942-57417964 CCATCTAGATCCTCGCTAATCAA 0: 1
1: 1
2: 1
3: 2
4: 62
Right 1008975190 6:57417979-57418001 TTATAAATCATTATTTTAACAGG 0: 1
1: 0
2: 12
3: 106
4: 761

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008975188 Original CRISPR TTGATTAGCGAGGATCTAGA TGG (reversed) Intronic
900297470 1:1959190-1959212 TAGATAAACAAGGATCTAGAAGG - Exonic
907864944 1:58390371-58390393 TTAATTACAGAGGCTCTAGAAGG + Intronic
912424317 1:109573112-109573134 TTGACTAGGGAAGATCTAGCAGG + Intronic
923061697 1:230481428-230481450 TTTATTAGCGAGGATGACGATGG + Intergenic
923881222 1:238105782-238105804 TGGATTAGGGAGGACCTTGAAGG + Intergenic
923910791 1:238441433-238441455 TTGATTAATGAGTATATAGATGG - Intergenic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1070358260 10:75661510-75661532 TTGAGTAGCAAGGAGCTAGTTGG + Intronic
1070541273 10:77417110-77417132 TTGATCAGGGAGGATGAAGATGG - Intronic
1072388899 10:94961590-94961612 TTCAATAGCGAGAATCTATAAGG - Intronic
1078214813 11:9302637-9302659 TTGAATAGCAAGGAGCTAGTTGG - Intronic
1080451954 11:32385123-32385145 GTGTGTAGCGAGGATCTACAGGG - Intergenic
1085941009 11:81207075-81207097 TTGAGTAGCAAAGAGCTAGATGG - Intergenic
1097686428 12:62695331-62695353 TTGATTAATGAGGATCCTGAGGG - Intronic
1099620837 12:85001055-85001077 ATGATTAGCGAGGATGTGGAGGG + Intergenic
1100636354 12:96438219-96438241 TTGATTTGAGAGGAACAAGAGGG + Intergenic
1100842621 12:98629170-98629192 TTGATTGGGGTGGACCTAGAAGG - Intronic
1103052321 12:117790931-117790953 TGGGTTAGAGAGGAGCTAGAGGG - Intronic
1105972746 13:25445784-25445806 TGGATTAGCGAAGACCAAGAAGG + Intronic
1109349353 13:61157516-61157538 TGGATTTCCGAGGTTCTAGATGG + Intergenic
1109707612 13:66118021-66118043 ATGATTAGCATGGATTTAGATGG - Intergenic
1112109825 13:96283903-96283925 TTGACTAGCAAGGTTATAGAGGG + Intronic
1124844774 15:33279640-33279662 TTAATTAGCAAGTACCTAGAGGG + Intergenic
1126068444 15:44844694-44844716 CTGATTATGGAGGATCTTGAAGG - Intergenic
1126090386 15:45046112-45046134 CTGATTATGGAGGATCTTGAAGG + Intronic
1126757234 15:51936520-51936542 TTGATTAGCCAGGAAATAGCTGG + Intronic
1140327051 16:74014677-74014699 ATGATTAGTTAGGTTCTAGATGG + Intergenic
1142021137 16:87783452-87783474 TTGACTACCAAGGCTCTAGATGG - Intergenic
1153545618 18:6202329-6202351 TTGATTATGCAGGATCTAGTAGG + Intronic
1153995424 18:10436695-10436717 GTGATTAACGAGAAACTAGATGG + Intergenic
1156669338 18:39448791-39448813 TTGATAAGAGAGGATCTGCATGG - Intergenic
1159114535 18:64099005-64099027 TTGAGCAGAGAGGATATAGAGGG + Intergenic
927050185 2:19320507-19320529 TTGATTAGTGCTGTTCTAGATGG - Intergenic
929744738 2:44645121-44645143 TTGATTTGGGAGAAACTAGAAGG + Intronic
930453203 2:51570649-51570671 TTGTTTAGAGAGGATGCAGAAGG - Intergenic
933300377 2:80533910-80533932 TTGATGAGCCAGCATCAAGAAGG + Intronic
941052756 2:160753274-160753296 TTGATTATTGAGAATCTTGAAGG + Intergenic
941768144 2:169321091-169321113 TTGATTAGTGTGTATCTTGATGG + Intronic
1173923003 20:46759929-46759951 TTCATTAGTGAGGATAAAGAGGG + Intergenic
1174862570 20:54104947-54104969 CTGATTAGGGAGGATCAGGAAGG - Intergenic
1178125799 21:29514373-29514395 TTGATTAGAGAAGATCTAATAGG - Intronic
956597745 3:70986611-70986633 TTGCTTAGCTGGGTTCTAGAAGG + Intronic
957653812 3:83044226-83044248 TTCATTAGAGAGGATCTAGAAGG - Intergenic
976381099 4:84399958-84399980 TGGATTTGGGAGGATATAGAGGG + Intergenic
981822412 4:148901271-148901293 TTGAAGAGCAAGGCTCTAGAGGG - Intergenic
983275525 4:165612657-165612679 TTTATTACAGAGGATTTAGAAGG + Intergenic
985035034 4:185830249-185830271 ATGATTTGAGAGCATCTAGAGGG - Intronic
986613160 5:9590050-9590072 TTGACAAACGAGGCTCTAGAGGG - Intergenic
996810959 5:127516110-127516132 TTGATCAGAGAGGATGAAGATGG + Intergenic
999545941 5:152628706-152628728 TTGAATAGTGAGGATTTAGAGGG + Intergenic
1004226778 6:13792381-13792403 TTGACTAAGGAGGATTTAGAAGG - Intronic
1005389154 6:25315812-25315834 TTGAGTAGCAAGGGACTAGAGGG - Intronic
1008928403 6:56911384-56911406 TTGAGTAACAAGGATGTAGAAGG + Intronic
1008975188 6:57417942-57417964 TTGATTAGCGAGGATCTAGATGG - Intronic
1009164073 6:60319461-60319483 TTGATTAGCAAGGATCTAGATGG - Intergenic
1009975265 6:70665299-70665321 TTGAATAGTGTGGTTCTAGATGG - Intergenic
1010467292 6:76183639-76183661 ATGATCAGTGAGGAACTAGAGGG + Intergenic
1017445342 6:154502508-154502530 TTGGTTAGGAAGGAACTAGAAGG + Intronic
1050884451 9:10746297-10746319 TTGAATAGCCAGGCTCCAGAGGG - Intergenic
1052952316 9:34222870-34222892 TTGAAAAGGTAGGATCTAGAGGG - Intronic
1057977833 9:99625232-99625254 TTGAGTAGCAAGGAATTAGAGGG + Intergenic
1185977033 X:4733079-4733101 TTGATTAGCGTGCATGTCGAAGG + Intergenic
1188239811 X:27772104-27772126 TTGATTAGAGAGGATTGACAGGG - Intergenic
1189178370 X:38980415-38980437 TTAAATATCCAGGATCTAGAAGG - Intergenic
1192601096 X:72464940-72464962 TTGATGAGCGTGGAAGTAGAGGG - Intronic
1198093985 X:133359904-133359926 TTCATAAGCGGGGTTCTAGAAGG + Intronic
1199165109 X:144663238-144663260 TTGAATATCCAGGATCTATAAGG - Intergenic