ID: 1008976706

View in Genome Browser
Species Human (GRCh38)
Location 6:57435437-57435459
Sequence CTGTAAGCACAGTTTTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008976706_1008976713 25 Left 1008976706 6:57435437-57435459 CCCAGCCAAAACTGTGCTTACAG 0: 1
1: 0
2: 0
3: 13
4: 159
Right 1008976713 6:57435485-57435507 CAAAGGAAATTTTGAAACTGAGG 0: 1
1: 0
2: 2
3: 55
4: 517
1008976706_1008976710 8 Left 1008976706 6:57435437-57435459 CCCAGCCAAAACTGTGCTTACAG 0: 1
1: 0
2: 0
3: 13
4: 159
Right 1008976710 6:57435468-57435490 CAACAGCCTGATCATTCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008976706 Original CRISPR CTGTAAGCACAGTTTTGGCT GGG (reversed) Intronic
901356904 1:8658056-8658078 CTGTAAGAACTGTGTTAGCTTGG - Intronic
902387003 1:16081821-16081843 CTGAAAGCAAAGCTTTGGGTGGG + Intergenic
903054191 1:20623849-20623871 CTGTAAACACAGTTTTTGATGGG + Intergenic
904172170 1:28599063-28599085 TTTAAAGGACAGTTTTGGCTTGG + Intronic
906018346 1:42603806-42603828 CTGTATGCAGGGTTTTGGGTAGG - Intronic
907217819 1:52880842-52880864 CTGCAATCAAAGTGTTGGCTGGG - Intronic
912162369 1:107001180-107001202 CTGGAATCAAGGTTTTGGCTTGG - Intergenic
916721701 1:167489201-167489223 CTATAAGCAGAGTTTGGGGTGGG - Intronic
916962377 1:169902300-169902322 CTGGAAGCACAGCTTTGGAGAGG - Intergenic
919983027 1:202654117-202654139 CAGTAAGCTCAGCTGTGGCTGGG - Intronic
921716449 1:218421971-218421993 CTGAAATCACGGTGTTGGCTGGG - Intronic
921832064 1:219738815-219738837 CTGTAAGCAGCATTTTGGCATGG + Intronic
924071879 1:240288931-240288953 CTGCAATCACAGTGTTGGCGGGG - Intronic
1064625276 10:17255023-17255045 CTCTAAGAAAAGTCTTGGCTAGG + Intergenic
1064809418 10:19178048-19178070 CTTTAACCACACTTTTGCCTCGG - Intronic
1065124156 10:22557114-22557136 CTCTAAGGACAGATTTGGCCAGG + Intronic
1065252766 10:23833211-23833233 CTGTAAGCCAAGCTTTTGCTAGG - Intronic
1065408766 10:25398133-25398155 CTGAAATCAAGGTTTTGGCTAGG - Intronic
1070611080 10:77933052-77933074 CTGCAAGCACAGTGCTGTCTGGG + Intergenic
1071541603 10:86489922-86489944 CTTAAGACACAGTTTTGGCTTGG + Intronic
1072846243 10:98833849-98833871 CTCTAAGCTCATTTTTGGCAGGG - Intronic
1074320701 10:112399295-112399317 CTTTAACAACAGTTTTGGCAGGG - Intronic
1074918601 10:117983476-117983498 CTGTGAGCACATTTTTGGATGGG - Intergenic
1077205551 11:1341471-1341493 CTGTCCGCACAGTTTAGGGTGGG + Intergenic
1077205559 11:1341529-1341551 CTGTCCGCACAGTTTAGGGTGGG + Intergenic
1079301415 11:19282506-19282528 CTGCAATCAAGGTTTTGGCTGGG - Intergenic
1080917473 11:36674266-36674288 CTGGAAGTCCAGTTTTGCCTGGG - Intergenic
1081484287 11:43515945-43515967 CTGTCAACACAGTGTTGGGTAGG - Intergenic
1083065255 11:59917070-59917092 CTGAATGCAGAGTTTTGGCATGG - Intergenic
1084946107 11:72639479-72639501 GTGTAAGAACAGCTTAGGCTGGG - Intronic
1086390789 11:86360685-86360707 CTGAAAACACAGTTCTGGCCAGG - Intergenic
1086930238 11:92684552-92684574 CTGTAATTACAGTATTTGCTTGG - Intronic
1087276350 11:96164169-96164191 GTGAAAGCGCAGTATTGGCTGGG - Intronic
1087586687 11:100130812-100130834 CAGGAAGTACAGTTTTGGCGGGG + Intronic
1087611044 11:100434301-100434323 CTGAAATCAAGGTTTTGGCTGGG - Intergenic
1090168696 11:124579101-124579123 CTACAAGCAGAGTTTTGGCTGGG - Intergenic
1090354636 11:126131840-126131862 CTGTAACCAAAATTTTGGCCAGG - Intergenic
1090428445 11:126626695-126626717 GAATAACCACAGTTTTGGCTGGG + Intronic
1090991870 11:131825038-131825060 CTGCAATCACAGTGTTGGCAGGG + Intronic
1091404773 12:202368-202390 CTGTAAACACAGTGAAGGCTGGG + Intronic
1096443789 12:51669834-51669856 GTGTCAGCACAGTTTTGGCAAGG - Intronic
1096625300 12:52891742-52891764 TTTTAAGAACAGTTTTAGCTAGG - Intergenic
1096889960 12:54759929-54759951 CCTTAAGCCCAGATTTGGCTTGG + Intergenic
1097383957 12:58927273-58927295 CTGTAGTCACAGTTGTGCCTGGG - Intergenic
1098743534 12:74205462-74205484 CTGTGATCACAGATTTGGGTTGG + Intergenic
1100559664 12:95735353-95735375 CCTTATCCACAGTTTTGGCTTGG + Intronic
1102351061 12:112192626-112192648 GTGCAAGCCCAGTGTTGGCTGGG + Exonic
1102639478 12:114354411-114354433 CAGTAAACACAGTTTTGTGTTGG + Exonic
1102710994 12:114926616-114926638 CTGTAATCAAAGTATTGGCTGGG - Intergenic
1104334757 12:127883614-127883636 CTGTAAGTACAGTTTTTCTTTGG - Intergenic
1106285321 13:28313554-28313576 CTGTAAGCACTATGTGGGCTGGG + Intronic
1110880239 13:80562838-80562860 CTGTAAGCATAGATCAGGCTGGG + Intergenic
1111718614 13:91913103-91913125 TTATAAGAAAAGTTTTGGCTGGG + Intronic
1112264935 13:97914762-97914784 CTGTAAGCAAGGTGTTGGCCAGG - Intergenic
1112296656 13:98193349-98193371 ATGTAAGAAGAGTCTTGGCTGGG - Intronic
1114268797 14:21089044-21089066 CTCTCAGCACACTTTGGGCTGGG + Exonic
1118873079 14:69759589-69759611 CCTTAAGAAAAGTTTTGGCTGGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1121591007 14:95109527-95109549 CTAAAAGCATAGTATTGGCTGGG - Intronic
1124845342 15:33284527-33284549 CTATTAGGTCAGTTTTGGCTTGG + Intergenic
1127237380 15:57069627-57069649 CTGTATGTAGAGATTTGGCTAGG + Intronic
1127310092 15:57744818-57744840 CTGAAGGCACAGTTTTGCCTTGG + Intronic
1128146638 15:65335661-65335683 CTGCAACCACAGTTTAGACTGGG - Intronic
1128426421 15:67546015-67546037 GTGTCTGCACACTTTTGGCTAGG + Intronic
1133687207 16:8177639-8177661 CAGAAACCCCAGTTTTGGCTGGG + Intergenic
1143575035 17:7787248-7787270 TTGTAAGCACTGTGTAGGCTTGG + Intronic
1148521813 17:48284004-48284026 CTGTGAGCTGAGTTTAGGCTGGG - Intronic
1151352696 17:73541155-73541177 CTGTGAGGACAGCTCTGGCTGGG + Intronic
1152373471 17:79905100-79905122 GTGTATGCACAGTCTTAGCTAGG + Intergenic
1157917496 18:51680461-51680483 CTTTAAGCCCAGATTTGCCTTGG - Intergenic
1158784311 18:60691039-60691061 CTGAAATCAAGGTTTTGGCTAGG + Intergenic
1163833213 19:19557673-19557695 CTGTAATCACCTTTATGGCTTGG + Intergenic
1165463904 19:35960658-35960680 CTGTAAGGACTGCTTTTGCTGGG - Intergenic
1167212768 19:48143803-48143825 CTCTAAGCAGAGTCTTGGTTGGG - Intronic
1168456614 19:56516125-56516147 CCATAAGTACTGTTTTGGCTTGG + Intronic
931313672 2:61105963-61105985 CTTTAAGAACAGCCTTGGCTGGG - Intronic
932595349 2:73089774-73089796 CTGGGAGCAGAGCTTTGGCTGGG - Intronic
934677748 2:96261577-96261599 CAAAAAGCACAGCTTTGGCTGGG + Intronic
935061816 2:99615277-99615299 CTGAAAGCCCTGTGTTGGCTTGG + Intronic
936247570 2:110842017-110842039 CTGTGAGCACAGTTTTTGTAAGG - Intronic
936876327 2:117194131-117194153 TTGTAATCATAGTTTTGTCTGGG - Intergenic
937546281 2:123025039-123025061 CTGTAGGAACAAGTTTGGCTTGG - Intergenic
938798058 2:134735267-134735289 CTGTGATTCCAGTTTTGGCTCGG - Intergenic
939480801 2:142744741-142744763 ATTTAAGGACACTTTTGGCTGGG - Intergenic
940679623 2:156769271-156769293 CTCTAAGCACTGCTTTGTCTAGG - Intergenic
944120239 2:196232822-196232844 CTGTTAGCTCTGTTTTTGCTTGG - Intronic
946158350 2:217821486-217821508 CTTCCAGCACAGTTTTGGATGGG + Intronic
948671478 2:239571363-239571385 CTCTGAGCACAGCCTTGGCTGGG + Intergenic
1172380146 20:34482856-34482878 CTGCAAGCAGACTTTTGCCTGGG + Intronic
1178726522 21:35057351-35057373 CTGAAAGCACAGGTATGGCCAGG + Intronic
1180588772 22:16917948-16917970 AAGTAAACACAGTTTTGGCCGGG + Intergenic
1180716010 22:17872987-17873009 CTGTGAGCACTGTGTTGGCATGG - Intronic
1181540715 22:23571714-23571736 CTGTAACATCTGTTTTGGCTTGG - Intergenic
1182725106 22:32439028-32439050 CAGAAAGCACAGATTGGGCTGGG + Intronic
950102524 3:10366739-10366761 CTGAAAGCTCAGCTGTGGCTCGG + Intronic
950969800 3:17174885-17174907 ATGTAAAAACAGTTCTGGCTGGG - Intronic
952143226 3:30502341-30502363 AGGTAAGCAGAGATTTGGCTGGG + Intergenic
952163544 3:30720804-30720826 CTGTAAGCACAAATTTAGTTAGG + Intergenic
953738266 3:45514631-45514653 CTGAAATCACAGCCTTGGCTTGG - Intronic
955267860 3:57464439-57464461 CCTTAAGCCCAGGTTTGGCTTGG - Intronic
956374654 3:68601368-68601390 CTGTGAGGACATTTTTGGCTAGG - Intergenic
960122557 3:113961923-113961945 CTAGAAGCACAGTTTTAGCCAGG + Exonic
960775893 3:121252828-121252850 CTGTAATCAAGGTGTTGGCTGGG + Intronic
963623961 3:147647585-147647607 CTGTAAGCCCAGCTGAGGCTGGG - Intergenic
964783863 3:160372028-160372050 CTTTAATCTCAGTTTTGGGTGGG - Intronic
967535800 3:190601277-190601299 GTATAACCAAAGTTTTGGCTGGG - Intronic
973597592 4:52508258-52508280 CTGTAAGAACAGTCTTTGTTTGG + Intergenic
974160655 4:58133761-58133783 CTGGAATCAAGGTTTTGGCTGGG - Intergenic
974370414 4:61009742-61009764 CAGAAAACACATTTTTGGCTGGG + Intergenic
976022502 4:80646134-80646156 CTGGAGGCACTGTTGTGGCTTGG - Intronic
982910663 4:161137769-161137791 CCTTAAGCACAGATTTGCCTTGG - Intergenic
982949184 4:161667345-161667367 CTGTTAGTACAGTTTTTGTTAGG - Intronic
983926112 4:173404170-173404192 CTAAGAGCACAGTTTTGTCTTGG - Intronic
986112201 5:4730600-4730622 CTGGAAGCACAGTCTTTGTTCGG + Intergenic
987970393 5:24936541-24936563 CTTAAAACACACTTTTGGCTTGG - Intergenic
990790639 5:59474898-59474920 CTGTAGGAACAGTGTTGGTTGGG + Intronic
993869896 5:93240284-93240306 CTGTAACCACAGTTTAGGTGGGG + Intergenic
995034672 5:107519879-107519901 CTGTAAGCACCACTCTGGCTGGG + Intronic
995179275 5:109215166-109215188 CTTTAAGCAAAGCTTTGGCATGG - Intergenic
997145842 5:131432321-131432343 TTGTAAATAAAGTTTTGGCTGGG + Intronic
997653365 5:135537854-135537876 CTGTAAGCAAGTTTTTGGCAGGG + Intergenic
998846083 5:146311335-146311357 CTGAAAGTACAGTCCTGGCTGGG - Intronic
1000097096 5:157981072-157981094 ATATAAGCAAGGTTTTGGCTGGG - Intergenic
1000663441 5:163964778-163964800 TGGAAAGCACATTTTTGGCTTGG + Intergenic
1001380915 5:171305948-171305970 CTCTAAGCACTGTTTTGGCCAGG - Intergenic
1001562196 5:172677097-172677119 CTGTAAGCACACCTTGGGCCGGG + Intronic
1003599826 6:7506818-7506840 CTGAAAACAGAGTCTTGGCTAGG + Intergenic
1006139516 6:31920060-31920082 CTGGAACCTCAGGTTTGGCTTGG - Intronic
1006587686 6:35128147-35128169 CTGCAAGCAAAGTGTTAGCTGGG + Intronic
1008042817 6:46819765-46819787 CTGTCCACACAGATTTGGCTTGG - Intronic
1008869093 6:56250597-56250619 CTGAAATCAAAGTGTTGGCTAGG - Intronic
1008976706 6:57435437-57435459 CTGTAAGCACAGTTTTGGCTGGG - Intronic
1010547358 6:77174138-77174160 CTGGAGCCACAGTTTTGCCTGGG - Intergenic
1011538127 6:88400407-88400429 TAGTATCCACAGTTTTGGCTTGG + Intergenic
1012327719 6:97943766-97943788 CTGCAATCAAAGTTTTGGCTAGG + Intergenic
1013119067 6:107125476-107125498 CTAGAAGCATAGTTTTGGATTGG - Intergenic
1013312831 6:108913467-108913489 CTGTATGCCCTGTTTTGGCTAGG + Intronic
1014906535 6:127036583-127036605 CTGTGAGCAGAGTTTTGTCTAGG + Intergenic
1016725674 6:147363574-147363596 TTATAAGCACAGTTCTGGGTTGG - Exonic
1021597584 7:22333743-22333765 GTGTAAGCTCATATTTGGCTTGG + Intronic
1022432655 7:30341390-30341412 CTCTAAACACTGCTTTGGCTGGG + Intronic
1023317462 7:38954492-38954514 CTTTAGACAGAGTTTTGGCTAGG - Intergenic
1025022872 7:55493704-55493726 CTGTAAGCTCAGTGTTGGCGGGG - Intronic
1028085978 7:86638418-86638440 CTCTAAGCACAGTCATTGCTTGG - Intergenic
1033442185 7:141390174-141390196 CTTTTAACTCAGTTTTGGCTTGG - Intronic
1034211412 7:149366482-149366504 CAGTTAGCACATGTTTGGCTTGG + Intergenic
1034543903 7:151777273-151777295 CTGTGAGCACAGTGTCTGCTGGG + Intronic
1037525188 8:19717794-19717816 CTGTAACCCTAGTCTTGGCTAGG + Intronic
1038043761 8:23748979-23749001 TTATAAGCACACTTATGGCTGGG - Intergenic
1038077128 8:24088970-24088992 CTGTTAACACAGTTTTGCCCAGG + Intergenic
1038937487 8:32268219-32268241 CTGTAATCAAAGTACTGGCTAGG - Intronic
1039024770 8:33245792-33245814 CTTCAAGAACAGTTCTGGCTGGG - Intergenic
1041536546 8:58932621-58932643 CTGTAATCACATTTTCTGCTTGG + Intronic
1042237145 8:66624697-66624719 CTGTAAGCACAATTTAAGATAGG + Intergenic
1042283811 8:67084576-67084598 CTTTAAGGAAAGTTTTGGCCAGG + Intronic
1042408357 8:68432632-68432654 TTGAAATCACAGTTTTGACTGGG + Intronic
1043602171 8:81953865-81953887 CTTTAAGTATAGCTTTGGCTTGG - Intergenic
1044342661 8:91065334-91065356 CTGTCACCAAAGTTTTGCCTAGG - Intergenic
1044585678 8:93867302-93867324 ATGTAATCATTGTTTTGGCTGGG - Intronic
1044959423 8:97515780-97515802 CTATCAACATAGTTTTGGCTGGG - Intergenic
1045304103 8:100942047-100942069 CTGTAAGCACATTTTTATTTGGG + Intronic
1047896999 8:129377426-129377448 CTGTAATCAAGGTGTTGGCTAGG - Intergenic
1048313573 8:133345185-133345207 CTGTAAGGATATTTTGGGCTTGG - Intergenic
1052455382 9:28690278-28690300 CTGTAATCAGAGTGTGGGCTGGG - Intergenic
1053305213 9:36980136-36980158 CCCTAAGCATAGTCTTGGCTTGG - Intronic
1056304767 9:85279155-85279177 CTGTGGACACAATTTTGGCTAGG + Intergenic
1058326607 9:103706422-103706444 CTGTAATCAAGGTGTTGGCTAGG + Intergenic
1060008894 9:120026150-120026172 CTGAAATCAAAGTTTGGGCTGGG + Intergenic
1187018531 X:15355080-15355102 CTCTACACACAGTTTTGGCAAGG + Intronic
1188604690 X:32013557-32013579 CTATAAGCAAAGTATTGGCTAGG - Intronic
1195955296 X:110322569-110322591 TTGGAGGCACAGTTTTGGCAGGG + Intronic
1200965285 Y:9029913-9029935 CTGTATGCACACTTTTTGGTGGG + Intergenic
1201273353 Y:12276962-12276984 TTTTAAGTGCAGTTTTGGCTGGG + Intergenic