ID: 1008982345

View in Genome Browser
Species Human (GRCh38)
Location 6:57499427-57499449
Sequence AACCTACCTCAGGAGGAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008982345 Original CRISPR AACCTACCTCAGGAGGAGGT CGG (reversed) Intronic
903897340 1:26616418-26616440 AACCTACCTCATTAGGTTGTTGG - Intergenic
904591344 1:31617323-31617345 CACCTAACTGAGGAGGAGGATGG - Intergenic
904834085 1:33323793-33323815 GAGCTACCTGAGGAGGAGGCAGG - Exonic
905860104 1:41344694-41344716 CACCAACCTCAGGAGGAAGGTGG - Intergenic
909377887 1:74961095-74961117 TAGCTACCTCAGGAAGAGGGTGG - Intergenic
910836751 1:91521107-91521129 AGCCTACCTCAAGAGTAGCTGGG + Intronic
914330219 1:146662197-146662219 AACCTACTTGAGGTGGAGGGTGG - Intergenic
919728877 1:200900547-200900569 CTCCTTTCTCAGGAGGAGGTGGG + Intronic
919849908 1:201665603-201665625 AGCTGACCTCAGGAGGTGGTGGG - Intronic
920696260 1:208183376-208183398 AACCTTCCTCAGCAGGGGATGGG + Intronic
922663092 1:227447329-227447351 AAAATACCTCTGGAGGATGTAGG - Intergenic
923382798 1:233438455-233438477 AACCTCACTTAGGAGTAGGTAGG + Intergenic
1067166651 10:43870812-43870834 CACCTGCCTCAGGGGGAGGGTGG + Intergenic
1067173646 10:43927247-43927269 AACCCAGCTCAGGAGGAGGGTGG - Intergenic
1068049552 10:51932050-51932072 ATCCTACCTAATGAGGAGGATGG - Intronic
1070353186 10:75613207-75613229 GACCAAACTCAGGAGGAAGTGGG - Intronic
1070742743 10:78913434-78913456 CACCTGCCTCTCGAGGAGGTGGG - Intergenic
1074575967 10:114669728-114669750 AGCCTGCCTCAGGATGAAGTGGG + Intronic
1082685014 11:56227436-56227458 AACTTAACTAAGGAGGAGGAAGG + Intergenic
1083630183 11:64091261-64091283 ATCCTGCCTCAGAAGGAGGCTGG + Intronic
1084696035 11:70756140-70756162 AACCTGCCTCTGGGGGAGCTGGG - Intronic
1084859373 11:72008085-72008107 AACCTACCTCAGAGGGTTGTTGG + Intronic
1088502073 11:110492613-110492635 AGCCTCCCTCAGAAGGAGCTTGG - Intergenic
1090880297 11:130826817-130826839 AACCTAATTCAGGAGGCCGTTGG - Intergenic
1091857575 12:3752072-3752094 AACCTAACTCATGAGGTGATGGG - Intronic
1092360590 12:7833104-7833126 AACCTGCATCAGGTGAAGGTAGG + Intronic
1097038974 12:56142997-56143019 GACCTACAACAGGAGGATGTAGG - Exonic
1099137830 12:78930651-78930673 AACCTCCCAATGGAGGAGGTTGG - Intronic
1106106227 13:26735679-26735701 ATCAGACCCCAGGAGGAGGTGGG - Intergenic
1107883498 13:44854612-44854634 AACCTTCCTGGGGAGGTGGTAGG + Intergenic
1109683641 13:65784595-65784617 ACCCTAACTCAGTAGGGGGTGGG + Intergenic
1109940404 13:69356040-69356062 AACCTACTTTAGAAGGAGTTTGG - Intergenic
1121988514 14:98531254-98531276 TTTCTACCTGAGGAGGAGGTGGG + Intergenic
1129019418 15:72502931-72502953 AAGCTACCACAGGAGAAGGAAGG - Intronic
1130016150 15:80187958-80187980 GACCTAACTCAGGAGGAAGGAGG - Intergenic
1130904445 15:88229957-88229979 AACCTACATCTGGAGGTGGTGGG - Intronic
1132409057 15:101562821-101562843 CATCACCCTCAGGAGGAGGTGGG - Intergenic
1132529397 16:438113-438135 ACTCCATCTCAGGAGGAGGTGGG - Intronic
1133217007 16:4298752-4298774 ATCCTGCCTCAGGAGTAGCTGGG + Intergenic
1135946741 16:26871844-26871866 AATCTACCTTAGGAGGAAGTGGG + Intergenic
1140003333 16:71048709-71048731 AACCTACTTGAGGTGGAGGGTGG + Intronic
1141148087 16:81545970-81545992 GACCTACATCAGAAGGAAGTGGG + Intronic
1145911915 17:28548007-28548029 CACCTGCCTCAGGCGGAGGAAGG + Exonic
1146803244 17:35844351-35844373 CTCGTCCCTCAGGAGGAGGTGGG + Exonic
1146943729 17:36860521-36860543 CACCTACCTCAGTAGGGGATAGG + Intergenic
1148778434 17:50108742-50108764 AGCCTCCCTCAGGAGGTGGGAGG - Intronic
1150208487 17:63427796-63427818 ACCCTCCCTCAGGAGGAATTGGG + Intergenic
1151180577 17:72324705-72324727 TACCTACCTCATGAGGTTGTAGG - Intergenic
1152761230 17:82108009-82108031 AGCCTGCCCCAGGAGCAGGTGGG - Intronic
1153346771 18:4034574-4034596 AACCTTCCTCAGTAGGAAGTTGG + Intronic
1155354381 18:24937283-24937305 AACCTGACTCAGAAGGAGGCTGG + Intergenic
1156519410 18:37709216-37709238 AACCAACCTAAGAAGGAGGCTGG - Intergenic
1158220549 18:55146268-55146290 CACCAACCTGGGGAGGAGGTGGG - Intergenic
1161347418 19:3775239-3775261 AACCTGCCTCAGGTGCTGGTGGG + Intergenic
1163834253 19:19563523-19563545 AGCCTCCCCCAGGAGGAGGCTGG + Exonic
1164888986 19:31806914-31806936 GCCCTACCTCAGGAGGAAGGGGG + Intergenic
1165182631 19:33985839-33985861 AACCCTCCCCAGGAGGAAGTGGG + Intergenic
1166379690 19:42349487-42349509 CACCTACCCCAGGAGGAGGTGGG + Exonic
929968135 2:46550863-46550885 CACCTTCCACAGGAGAAGGTGGG + Intronic
935263577 2:101375691-101375713 ACCCTACCCCAGGACGGGGTGGG + Intronic
937264171 2:120605711-120605733 AATTGACCTGAGGAGGAGGTGGG - Intergenic
938682158 2:133703016-133703038 AAGCTATCTCTGGAGGAGGAAGG + Intergenic
939223704 2:139337929-139337951 TACCTATCTCAGGAGAAGGAAGG + Intergenic
939568276 2:143810573-143810595 TTCCTACAGCAGGAGGAGGTTGG - Intergenic
940437122 2:153668669-153668691 CACCTTCCCCAGGAGTAGGTGGG - Intergenic
944583363 2:201152400-201152422 GACCTACCTCATAGGGAGGTTGG + Intronic
944755038 2:202752604-202752626 AACCTCTTTCAGGAAGAGGTGGG - Intronic
945539320 2:211064682-211064704 AACCTATCTCAGGAGGTATTTGG - Intergenic
945920224 2:215748226-215748248 CACTTATCTGAGGAGGAGGTGGG + Intergenic
1170405715 20:16033838-16033860 AACCTATCACAGTAGGGGGTGGG + Intronic
1170937405 20:20822132-20822154 CACATTCCTCAGGAGGAGGCAGG - Intergenic
1172123347 20:32611175-32611197 AACCTTGCTCAGCAGGGGGTGGG + Intergenic
1172508172 20:35479576-35479598 ACCCTTCCTCAAGAGGAGCTGGG - Intronic
1172962610 20:38809150-38809172 ACCCTAGCACTGGAGGAGGTGGG - Intronic
1174522643 20:51143593-51143615 AACTTATCTCTGGCGGAGGTCGG + Intergenic
1179206418 21:39284468-39284490 AACCTGCCTCTGGGGGAGGCGGG + Intronic
1179611003 21:42549992-42550014 AAAATACATCAGCAGGAGGTGGG - Intronic
1180232833 21:46437589-46437611 AAGCTGCCTCTGAAGGAGGTGGG + Intronic
1180922269 22:19527045-19527067 AACCCACCTCAGATGGAGGCTGG + Exonic
1183317302 22:37143723-37143745 CACCTGCCAGAGGAGGAGGTGGG + Intronic
1184321849 22:43747905-43747927 CACCTAGATCAGGAGGAGTTAGG - Intronic
1184923128 22:47619819-47619841 AGCCTCCCTCAGGAGGGTGTGGG - Intergenic
950341854 3:12253888-12253910 AAACTACCTAAGGAAGAGGGAGG - Intergenic
959805460 3:110547138-110547160 AACCTACCTCAAGAGAAATTTGG - Intergenic
961676508 3:128570397-128570419 AAGCAACCTGAAGAGGAGGTTGG + Intergenic
963019563 3:140859700-140859722 AGCCTGACTCAGGAGGAGGAAGG + Intergenic
965260796 3:166482481-166482503 AACCTTCTTCACAAGGAGGTAGG - Intergenic
967351903 3:188523245-188523267 AACCTACTTCAAGAGGCAGTTGG - Intronic
970876628 4:20878182-20878204 TACCTACCTCAGAAGGTGGTTGG + Intronic
974850128 4:67394408-67394430 AACCTACTTTAGAAGAAGGTCGG - Intergenic
977908009 4:102500231-102500253 AACCTACTGGAGGAGGAGGATGG + Intergenic
988342636 5:29993860-29993882 AACCTACTTCAGAGGAAGGTCGG - Intergenic
993081343 5:83304287-83304309 CTCCTACCTCTGGAGTAGGTGGG + Intronic
995462964 5:112421411-112421433 AACTTACCTTATGAGGAGCTGGG - Intergenic
1000989556 5:167898031-167898053 AACCCAGATCAGCAGGAGGTAGG - Intronic
1001604817 5:172952000-172952022 GACCCACCTCAGGAGCAGGTGGG - Exonic
1002046406 5:176543814-176543836 TACCTTCTTCAGGAGGAGGATGG + Intronic
1002668721 5:180847364-180847386 ATCCTAACTCGGGAGCAGGTAGG - Intergenic
1006822979 6:36913317-36913339 ATCCCAGCTCAGGAGGGGGTGGG - Intronic
1007017823 6:38487278-38487300 GACCTACCTTAGGAGGGGGTGGG + Intronic
1007756219 6:44101390-44101412 AACCTACCTCATGAGGCCGCTGG + Intergenic
1008982345 6:57499427-57499449 AACCTACCTCAGGAGGAGGTCGG - Intronic
1009306708 6:62099763-62099785 GACCTACCTCAGCAGCAGGTAGG - Intronic
1011515737 6:88150586-88150608 AACCTCCATCAGTAGGAGGCTGG - Intronic
1012847984 6:104413641-104413663 AACCAACCCCAGAAGGAGGAGGG - Intergenic
1013154261 6:107477980-107478002 CAGCTACCTGAGGGGGAGGTGGG + Intergenic
1013460339 6:110369086-110369108 TACCTACCTCACAAGGATGTTGG + Intergenic
1017124784 6:151055361-151055383 AATCTACCTCAAGAGGTGCTGGG - Intronic
1021839791 7:24713312-24713334 AACCTGCATCAGGGGAAGGTTGG + Intronic
1022117875 7:27278011-27278033 AAAAGACCTCTGGAGGAGGTAGG - Intergenic
1023301736 7:38780378-38780400 CACCTCCATCAGGAGGAGGAAGG - Intronic
1032391477 7:131557678-131557700 CACCTACCTCAGGGGGTTGTTGG + Intronic
1032695417 7:134331601-134331623 ACCCTAACTCAGGATGAGCTTGG - Intergenic
1035575019 8:698842-698864 ATCCTACCTGAGGAGGACGGAGG - Intronic
1037890790 8:22622832-22622854 AGCCTTCTGCAGGAGGAGGTAGG - Intronic
1040007158 8:42630235-42630257 TACCTAAATCAGGTGGAGGTAGG + Intergenic
1040536906 8:48318599-48318621 AACCTTCCGCTGGAGCAGGTCGG - Intergenic
1040856996 8:51958675-51958697 TTCCTACCTCAGAAGGAGCTGGG + Intergenic
1042131017 8:65586843-65586865 AACCCACCTCAAGAGGGGGTTGG - Intergenic
1049784221 8:144442904-144442926 CACCCACCTCGGGAGGAGGGAGG - Intronic
1050978933 9:11982474-11982496 AACAAACGTGAGGAGGAGGTTGG + Intergenic
1053744707 9:41184131-41184153 AACCTTCCTCAGGATGAACTAGG - Intronic
1054683639 9:68247135-68247157 AACCTTCCTCAGGATGAACTAGG + Intronic
1055659295 9:78486283-78486305 AAGCAACCTCAGGATGGGGTGGG + Intergenic
1057164785 9:92916973-92916995 CACTTGCCCCAGGAGGAGGTGGG + Intergenic
1059599724 9:115763675-115763697 AATCTAGCTCAGAAGGAGGAAGG - Intergenic
1186409514 X:9334387-9334409 AACGTATCTCAAGACGAGGTGGG - Intergenic
1188137161 X:26504738-26504760 TACCTAGCAGAGGAGGAGGTAGG - Intergenic
1190725764 X:53189720-53189742 AATCTAGCTTAGAAGGAGGTAGG - Intergenic
1192404727 X:70873251-70873273 CACTTACCATAGGAGGAGGTTGG - Exonic
1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG + Exonic