ID: 1008985928

View in Genome Browser
Species Human (GRCh38)
Location 6:57543026-57543048
Sequence AGAATGGCGTGAAGCCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2632
Summary {0: 2, 1: 337, 2: 432, 3: 637, 4: 1224}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008985928_1008985936 4 Left 1008985928 6:57543026-57543048 CCCCCTGGGCTTCACGCCATTCT 0: 2
1: 337
2: 432
3: 637
4: 1224
Right 1008985936 6:57543053-57543075 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
1008985928_1008985934 3 Left 1008985928 6:57543026-57543048 CCCCCTGGGCTTCACGCCATTCT 0: 2
1: 337
2: 432
3: 637
4: 1224
Right 1008985934 6:57543052-57543074 GCCTCAGCCTCCCGAGTAGCTGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
1008985928_1008985938 12 Left 1008985928 6:57543026-57543048 CCCCCTGGGCTTCACGCCATTCT 0: 2
1: 337
2: 432
3: 637
4: 1224
Right 1008985938 6:57543061-57543083 TCCCGAGTAGCTGGGACTACAGG 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008985928 Original CRISPR AGAATGGCGTGAAGCCCAGG GGG (reversed) Intronic
Too many off-targets to display for this crispr