ID: 1008985936

View in Genome Browser
Species Human (GRCh38)
Location 6:57543053-57543075
Sequence CCTCAGCCTCCCGAGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 901262
Summary {0: 99957, 1: 284367, 2: 226920, 3: 125442, 4: 164576}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008985929_1008985936 3 Left 1008985929 6:57543027-57543049 CCCCTGGGCTTCACGCCATTCTC 0: 2
1: 407
2: 1600
3: 38713
4: 55008
Right 1008985936 6:57543053-57543075 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
1008985928_1008985936 4 Left 1008985928 6:57543026-57543048 CCCCCTGGGCTTCACGCCATTCT 0: 2
1: 337
2: 432
3: 637
4: 1224
Right 1008985936 6:57543053-57543075 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
1008985931_1008985936 1 Left 1008985931 6:57543029-57543051 CCTGGGCTTCACGCCATTCTCCT 0: 3
1: 686
2: 979
3: 1470
4: 3562
Right 1008985936 6:57543053-57543075 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
1008985930_1008985936 2 Left 1008985930 6:57543028-57543050 CCCTGGGCTTCACGCCATTCTCC 0: 2
1: 298
2: 430
3: 987
4: 1795
Right 1008985936 6:57543053-57543075 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
1008985927_1008985936 7 Left 1008985927 6:57543023-57543045 CCGCCCCCTGGGCTTCACGCCAT 0: 2
1: 287
2: 292
3: 309
4: 622
Right 1008985936 6:57543053-57543075 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008985936 Original CRISPR CCTCAGCCTCCCGAGTAGCT GGG Intronic
Too many off-targets to display for this crispr