ID: 1008985938

View in Genome Browser
Species Human (GRCh38)
Location 6:57543061-57543083
Sequence TCCCGAGTAGCTGGGACTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 802747
Summary {0: 54379, 1: 173656, 2: 264604, 3: 194654, 4: 115454}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008985927_1008985938 15 Left 1008985927 6:57543023-57543045 CCGCCCCCTGGGCTTCACGCCAT 0: 2
1: 287
2: 292
3: 309
4: 622
Right 1008985938 6:57543061-57543083 TCCCGAGTAGCTGGGACTACAGG 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
1008985931_1008985938 9 Left 1008985931 6:57543029-57543051 CCTGGGCTTCACGCCATTCTCCT 0: 3
1: 686
2: 979
3: 1470
4: 3562
Right 1008985938 6:57543061-57543083 TCCCGAGTAGCTGGGACTACAGG 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
1008985929_1008985938 11 Left 1008985929 6:57543027-57543049 CCCCTGGGCTTCACGCCATTCTC 0: 2
1: 407
2: 1600
3: 38713
4: 55008
Right 1008985938 6:57543061-57543083 TCCCGAGTAGCTGGGACTACAGG 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
1008985930_1008985938 10 Left 1008985930 6:57543028-57543050 CCCTGGGCTTCACGCCATTCTCC 0: 2
1: 298
2: 430
3: 987
4: 1795
Right 1008985938 6:57543061-57543083 TCCCGAGTAGCTGGGACTACAGG 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
1008985928_1008985938 12 Left 1008985928 6:57543026-57543048 CCCCCTGGGCTTCACGCCATTCT 0: 2
1: 337
2: 432
3: 637
4: 1224
Right 1008985938 6:57543061-57543083 TCCCGAGTAGCTGGGACTACAGG 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
1008985932_1008985938 -4 Left 1008985932 6:57543042-57543064 CCATTCTCCTGCCTCAGCCTCCC 0: 61556
1: 45979
2: 19513
3: 9543
4: 8794
Right 1008985938 6:57543061-57543083 TCCCGAGTAGCTGGGACTACAGG 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008985938 Original CRISPR TCCCGAGTAGCTGGGACTAC AGG Intronic
Too many off-targets to display for this crispr