ID: 1008986302

View in Genome Browser
Species Human (GRCh38)
Location 6:57547727-57547749
Sequence CCTTAAGCATGCTGTCATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 3, 1: 0, 2: 0, 3: 6, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008986302_1008986304 1 Left 1008986302 6:57547727-57547749 CCTTGATGACAGCATGCTTAAGG 0: 3
1: 0
2: 0
3: 6
4: 143
Right 1008986304 6:57547751-57547773 CTATTATATGTTGTTATAATTGG No data
1008986302_1008986305 2 Left 1008986302 6:57547727-57547749 CCTTGATGACAGCATGCTTAAGG 0: 3
1: 0
2: 0
3: 6
4: 143
Right 1008986305 6:57547752-57547774 TATTATATGTTGTTATAATTGGG 0: 3
1: 0
2: 5
3: 56
4: 675
1008986302_1008986306 8 Left 1008986302 6:57547727-57547749 CCTTGATGACAGCATGCTTAAGG 0: 3
1: 0
2: 0
3: 6
4: 143
Right 1008986306 6:57547758-57547780 ATGTTGTTATAATTGGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008986302 Original CRISPR CCTTAAGCATGCTGTCATCA AGG (reversed) Intronic
902179424 1:14676660-14676682 CCTTTAGCATGATGTTTTCAAGG - Intronic
902429324 1:16351105-16351127 GCTTAAGAATGATGACATCATGG - Intronic
902539272 1:17141217-17141239 CATTGAGCATGATGTCCTCAAGG - Intergenic
905653464 1:39671663-39671685 CCTCCCCCATGCTGTCATCAGGG - Intronic
907450630 1:54543508-54543530 CCTTGAGCTAGCTGGCATCAGGG - Intronic
907539063 1:55195657-55195679 CACTAAGCATGATGTCCTCAAGG - Intronic
914459723 1:147872226-147872248 CCTTAAGAAAGCTGCCTTCAAGG + Intergenic
917110193 1:171539655-171539677 ACTTAAGCATAATGTCCTCAGGG + Intronic
921362197 1:214340593-214340615 CCTTAAGAATTCTGACATAAAGG + Intergenic
922165304 1:223110664-223110686 CCTTAACAGTGCTCTCATCATGG - Exonic
922727250 1:227928184-227928206 CCTGAAGCATGCAGACAGCAGGG + Intronic
923981428 1:239328366-239328388 TCTCAAGCCTGCTGTCCTCAAGG + Intergenic
924003891 1:239585512-239585534 CTTTAATCATGTTGTCATAAAGG + Intronic
1063587486 10:7365688-7365710 TCTTAAGCATAGTGTCCTCAGGG - Intronic
1064215477 10:13396737-13396759 CCTTTAGCATAATGTCCTCAAGG + Intergenic
1067535441 10:47106419-47106441 CACTAAGCATGATGTCCTCAAGG + Intergenic
1070501290 10:77075113-77075135 ATTTAACCATGCTCTCATCAGGG - Intronic
1072078499 10:92003527-92003549 CCTTTAGCATAATGTCATCCAGG + Intronic
1072189888 10:93070554-93070576 CCTTAAGCATGAGGTCAGGAGGG - Intergenic
1073786349 10:106894415-106894437 CCTTTAGACTGCTGTCAACATGG - Intronic
1076942198 10:133617361-133617383 CCCTAAGCTTGATGCCATCAAGG - Intergenic
1080013250 11:27479025-27479047 TCTTCAGCATGAGGTCATCATGG - Intergenic
1080034229 11:27695513-27695535 TCTTAAACATGCTTTCATCTTGG - Intronic
1081299442 11:41432690-41432712 CCTATAGGATACTGTCATCATGG + Intronic
1082632930 11:55561994-55562016 CCATAACCATGCTGCCATCTGGG + Intergenic
1083345242 11:61984989-61985011 CATTTAGCATGATGTCTTCAGGG + Intergenic
1085301223 11:75459925-75459947 GCTTCAGCCTGCTGTCATCTGGG + Intronic
1088820901 11:113456616-113456638 CCCTTAGCATGCTGTCTTCAAGG - Intronic
1095404115 12:41849021-41849043 CATTCAGCATGGTGTCTTCAGGG - Intergenic
1097551157 12:61071757-61071779 GCTAAAGCATGCTGACATGAAGG - Intergenic
1099891958 12:88600317-88600339 CCTCCAGCATGGTGGCATCATGG - Intergenic
1100293754 12:93241361-93241383 TCTTAAGAATGCTGTCATCTGGG - Intergenic
1101208895 12:102516464-102516486 CACTTAGCATGATGTCATCAAGG - Intergenic
1101657288 12:106734035-106734057 CATTAAGCATACTATCTTCAAGG - Intronic
1103048559 12:117759765-117759787 CTCTTAGCATGCTGTCTTCAAGG + Intronic
1107820340 13:44280213-44280235 CCTTTAGCATAGTGTCCTCATGG + Intergenic
1107976688 13:45695136-45695158 CATTTAGCATACTGGCATCAAGG - Intergenic
1112829349 13:103429470-103429492 CCCCAAGCATGCAGACATCATGG - Intergenic
1113001668 13:105645878-105645900 ACAAAAACATGCTGTCATCAGGG + Intergenic
1114613602 14:24057050-24057072 GCTTAAGCATGCTTTCTGCAGGG - Intronic
1121838635 14:97114765-97114787 ACTTAAACCGGCTGTCATCATGG - Intergenic
1124868548 15:33517874-33517896 ATTAAATCATGCTGTCATCAAGG - Intronic
1127101579 15:55571143-55571165 CATTAAGCATAATGTCCTCAAGG + Intronic
1128756134 15:70185285-70185307 CCATAAGCCTGCTGTCAGCTGGG + Intergenic
1129887188 15:79046903-79046925 TCTTGCGCATGCTGTCAGCATGG + Exonic
1133503189 16:6385129-6385151 GCCTCAGCATGGTGTCATCATGG + Intronic
1133702733 16:8324363-8324385 CCTTTGGCATGCTGTTCTCATGG + Intergenic
1136931549 16:34422279-34422301 CCTTTAGCATAATGTCCTCAGGG - Intergenic
1136973023 16:34989540-34989562 CCTTTAGCATAATGTCCTCAGGG + Intergenic
1139609114 16:68042143-68042165 CCCTTAGCATAATGTCATCAAGG + Intronic
1141350124 16:83287041-83287063 CCTTCAGCATGCGCTCATGAAGG - Intronic
1141735640 16:85850653-85850675 CCTGGAGCATGCTGTTTTCATGG - Intergenic
1143381059 17:6496627-6496649 CCTTAAGGATCTTGTCATCTGGG - Intronic
1146659363 17:34654096-34654118 CCTTGAGCACCCTGTCTTCAGGG + Intergenic
1149319931 17:55472407-55472429 CCATAACCATGCTGCCATCTGGG + Intergenic
1152366062 17:79857154-79857176 CCTAAATCAAGGTGTCATCAGGG - Intergenic
1155068453 18:22289773-22289795 CACTAAGCATAATGTCATCAAGG + Intergenic
1159036324 18:63281047-63281069 CACTAAGCATGATGTCTTCAAGG - Intronic
1159359738 18:67384270-67384292 CTTTTTGCATGCTGTCATCCAGG + Intergenic
1161371084 19:3911877-3911899 CTTTAAACATGCTGTTTTCAAGG + Intronic
1161995020 19:7706769-7706791 CCTAAAGGAGGCTGTCATGAAGG - Intergenic
1162023822 19:7882131-7882153 CCCTGAGCATGATGTCCTCATGG - Intergenic
1164419017 19:28071331-28071353 CCCTCAACATGTTGTCATCATGG + Intergenic
1164879957 19:31724444-31724466 CCTTTAGCATAATGTCCTCAAGG + Intergenic
1168232192 19:55039897-55039919 CCTTTAGCATAATGTCTTCAAGG - Intronic
925747117 2:7052696-7052718 CCTAAAACATGCTCTCAGCATGG - Intronic
928367875 2:30716592-30716614 CCTTAAGCTTGCATTCATTAGGG + Intergenic
931079006 2:58748006-58748028 CTTTAAGCCTGCTTTTATCAGGG + Intergenic
931662227 2:64576333-64576355 CCAAAAGCATGCAGTCATAAGGG - Intronic
931736960 2:65204387-65204409 CCTCAAGCATGGTGTGACCAGGG - Intergenic
933782723 2:85813284-85813306 CCTTAATTGTTCTGTCATCAGGG + Intergenic
934063339 2:88317536-88317558 CCTCCAGCATGCTGGCAACAAGG - Intergenic
934141638 2:89052888-89052910 CCATAACCATGCTGCCATCTGGG + Intergenic
934227606 2:90147658-90147680 CCATAACCATGCTGCCATCTGGG - Intergenic
943371314 2:187019969-187019991 CTTAAAGCATGATGTCATGAGGG - Intergenic
1170909715 20:20553631-20553653 CCTAAAGCATGCTGCTGTCAAGG - Intronic
1174096662 20:48095160-48095182 TCTTTAGCATTATGTCATCAAGG - Intergenic
1174588245 20:51625191-51625213 CCTGAGGAATGCTGGCATCAAGG - Exonic
1175406007 20:58729156-58729178 ACTTAAGCATAATGTCTTCAAGG - Intergenic
1177062727 21:16394870-16394892 CCATAACCATGCTGCCATCTGGG - Intergenic
950744485 3:15075774-15075796 GCTTAAGCAGACTCTCATCATGG - Intronic
952150697 3:30586832-30586854 CCTCAAGCTTGCTGGCATGATGG + Intergenic
952914236 3:38220669-38220691 CCTTCAGGATGCTGTTAGCATGG + Intronic
954532665 3:51334237-51334259 CCTTAATCATTCTCTCAGCAGGG + Intronic
954795564 3:53159919-53159941 CCTTGAGCATGCTGTTCTCTGGG - Intronic
958268927 3:91474010-91474032 CCTTAAGCATGCTGTCATCAAGG + Intergenic
960996088 3:123341339-123341361 CATTTAGCATGATGTCTTCAAGG - Intronic
967130905 3:186469807-186469829 CCTTTAGCATCCTGTCATAATGG + Intergenic
969860183 4:10029391-10029413 CCTAAAGCATCCCATCATCAAGG - Intronic
970091980 4:12420072-12420094 ACTTAATCTTGCTATCATCATGG + Intergenic
970962596 4:21890394-21890416 CCTTAAGTGTGATGTCATCTGGG + Intronic
973108836 4:46375662-46375684 CTTTAAGTATTCTGTCATAAAGG - Intronic
974255879 4:59454524-59454546 TCTTGGGCATGCTGTCATCTCGG + Intergenic
975653813 4:76620991-76621013 CCTTAAGCATCCTGCCCTCCAGG + Intronic
975654366 4:76626901-76626923 CATTAGCCATGATGTCATCATGG - Intronic
976388517 4:84485528-84485550 CCTTAAGTGTGCTGACAGCAAGG + Intergenic
976714245 4:88106474-88106496 CCTTTAGCATGTTGTCTTTATGG - Intronic
977730262 4:100342698-100342720 CGTTAAGTATGATGTCATCCTGG - Intergenic
982470924 4:155789125-155789147 TCTTTAGTATGCTATCATCAAGG - Intronic
983567031 4:169164111-169164133 CCTTATGAATACTGTTATCATGG + Intronic
985117953 4:186609800-186609822 TCTTGAGCAGTCTGTCATCACGG - Exonic
985835964 5:2272162-2272184 ACTTAAGGATGCTGTCATTCTGG - Intergenic
986129781 5:4918501-4918523 CACTCAGCATGCTGTCTTCAAGG - Intergenic
988996712 5:36722060-36722082 CCTCAAGCCTGCTGGCCTCATGG + Intergenic
990242084 5:53825977-53825999 CCCTTAGCATAATGTCATCAAGG - Intergenic
991521548 5:67503832-67503854 CCAGAAGCCTGCTGTCAACAAGG + Intergenic
993805192 5:92399182-92399204 CCTTAAGCATGATATTTTCAAGG - Intergenic
994192968 5:96889044-96889066 CATTAAGCATGTTGTCAATAAGG - Intronic
995131133 5:108631571-108631593 CTTTAAGCCTGGTTTCATCAGGG - Intergenic
997234786 5:132266491-132266513 CCTGAGCCTTGCTGTCATCAGGG - Exonic
998918802 5:147044639-147044661 GCTTAAGCATCCTGTCATCTGGG + Intronic
1000427372 5:161107763-161107785 CATTTAGCATGATGTCCTCAAGG - Intergenic
1002312151 5:178321417-178321439 CCCTGAGCATGGTGTCCTCAAGG + Intronic
1007243770 6:40445375-40445397 CCTTGAGAATGATGTCATCTGGG - Intronic
1008986302 6:57547727-57547749 CCTTAAGCATGCTGTCATCAAGG - Intronic
1009174263 6:60440289-60440311 CCTTAAGCATGCTGTCATCAAGG - Intergenic
1012827058 6:104159875-104159897 CCTTAAGCACTATGTCTTCAAGG - Intergenic
1021482375 7:21131982-21132004 CCCTAAGCATAATGTCCTCAAGG - Intergenic
1022806539 7:33828463-33828485 TCTTAAGCCTACTGTCATGAAGG - Intergenic
1022954351 7:35367567-35367589 CCTCAAGCATGCTGGCCTCAGGG + Intergenic
1027801058 7:82749548-82749570 CCTTTAAAATGCAGTCATCAAGG + Intergenic
1030193833 7:106834216-106834238 CCATAACCATGCTGCCATCTGGG + Intergenic
1033716456 7:144008059-144008081 CCAAAATCAAGCTGTCATCAGGG - Intergenic
1034029959 7:147750585-147750607 CCTGAAGCAATCTGGCATCATGG - Intronic
1034071485 7:148190232-148190254 CCTTGAGCATGGTGGCCTCAGGG - Intronic
1038504091 8:28069560-28069582 CATTAGGGATGCTGTCATCCAGG + Exonic
1039788688 8:40856644-40856666 CCTGGAGCATGTTGTCATAAAGG + Intronic
1040397933 8:47017136-47017158 CCTTAAGAATTCTGACAACAGGG - Intergenic
1041146205 8:54878878-54878900 CATTAAGCATAATGTCTTCAAGG + Intergenic
1042768715 8:72355501-72355523 CCTTAACCATGGTGTCCTCAGGG - Intergenic
1043721126 8:83547722-83547744 CCATAACCATGCTGCCATCTGGG + Intergenic
1043831111 8:84990560-84990582 CCTCAATCAAGTTGTCATCAGGG + Intergenic
1044216242 8:89614072-89614094 CCATAAGCAACCTGTCCTCAAGG - Intergenic
1046987081 8:120399720-120399742 CCATCAGTATGCTGTCTTCAAGG + Intronic
1048774278 8:137928489-137928511 CCCTAAGCATATTGTGATCATGG - Intergenic
1049366883 8:142243460-142243482 ACTTAAGCATGATGTCTTCCAGG - Intronic
1049502142 8:142972837-142972859 CCCTCGGCATGATGTCATCAGGG - Intergenic
1049806232 8:144541642-144541664 CCTTTAGCATGATGCCCTCAAGG + Intronic
1050015866 9:1233603-1233625 ATTTAAGCATTCTTTCATCATGG + Intergenic
1050905840 9:11004316-11004338 CCTTATCCATGCCCTCATCAAGG - Intergenic
1051282186 9:15453147-15453169 CCTTACTTATACTGTCATCAGGG + Exonic
1052282760 9:26752113-26752135 CATTGAGCATGATGTCCTCAAGG - Intergenic
1054790537 9:69252555-69252577 CCCTTAGCATGATGTCCTCAAGG + Intronic
1059074768 9:111181136-111181158 TCTCAAGCATGCTTTCATCTGGG - Intergenic
1185626480 X:1486428-1486450 CCCTGAGCATGATGTCTTCAAGG - Intronic
1187432034 X:19233963-19233985 GCTTAAACATGCTGTTTTCATGG - Intergenic
1188240500 X:27782140-27782162 ACTAAAGGATGCTGTCATTAAGG - Intergenic
1199784031 X:151088300-151088322 CCTTAACCATGCTGGGATGAGGG - Intergenic
1200007473 X:153097144-153097166 CCATAACCATGCTGCCATCTGGG - Intergenic
1201731465 Y:17208929-17208951 CCTTCAGCATGCAGACATCTTGG - Intergenic
1202123941 Y:21553017-21553039 CCTTCTGCATAGTGTCATCAGGG + Intergenic
1202155067 Y:21876363-21876385 CCTTCTGCATAGTGTCATCAGGG - Intergenic