ID: 1008986306

View in Genome Browser
Species Human (GRCh38)
Location 6:57547758-57547780
Sequence ATGTTGTTATAATTGGGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008986302_1008986306 8 Left 1008986302 6:57547727-57547749 CCTTGATGACAGCATGCTTAAGG 0: 3
1: 0
2: 0
3: 6
4: 143
Right 1008986306 6:57547758-57547780 ATGTTGTTATAATTGGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008986306 Original CRISPR ATGTTGTTATAATTGGGTCA AGG Intronic
No off target data available for this crispr