ID: 1008988417

View in Genome Browser
Species Human (GRCh38)
Location 6:57574374-57574396
Sequence TGTAGACTTATTGAAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 2, 2: 0, 3: 9, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008988417_1008988421 30 Left 1008988417 6:57574374-57574396 CCTCCCACTTCAATAAGTCTACA 0: 1
1: 2
2: 0
3: 9
4: 113
Right 1008988421 6:57574427-57574449 GTTCTGTGTTCAGTGTGCCAAGG 0: 3
1: 0
2: 1
3: 18
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008988417 Original CRISPR TGTAGACTTATTGAAGTGGG AGG (reversed) Intronic
906822290 1:48942294-48942316 TGTTGAATTATTGTGGTGGGGGG + Intronic
909937819 1:81574201-81574223 TGAATACTTATAGAAGTGGGTGG + Intronic
909942402 1:81625770-81625792 TGTAGACTATTTGATGTTGGCGG - Intronic
913355088 1:117912182-117912204 AGTAGATTTGTTGAAGAGGGAGG - Intronic
914883553 1:151566429-151566451 TGTTAACAGATTGAAGTGGGTGG + Intronic
917560430 1:176147246-176147268 TGCAGACAGATTGAAGTGAGTGG - Intronic
918616730 1:186552936-186552958 TATAGACTTATTTATGTGGATGG + Intergenic
919721925 1:200846566-200846588 TGGAGACTTATAGAAATGAGAGG - Intronic
921109848 1:212024923-212024945 TGTAGTCTAATTGAAGTTTGAGG - Intronic
923343711 1:233030980-233031002 TGTGGTCTTATTGAACTAGGGGG - Intronic
1065983600 10:30928136-30928158 TATTGACATTTTGAAGTGGGTGG - Intronic
1067086874 10:43246260-43246282 TGTAGACTTAAATAAGTGGAAGG + Intronic
1068283225 10:54903877-54903899 TGTAGTTTTATTGTTGTGGGAGG - Intronic
1069117177 10:64522070-64522092 TGTTGATGAATTGAAGTGGGAGG - Intergenic
1069716972 10:70527363-70527385 TGTAGAATGTTTGAAGTGGAAGG + Intronic
1071208410 10:83310874-83310896 TGGTGACTTATTGAAATGGCAGG + Intergenic
1072254551 10:93609019-93609041 TGGACAATTTTTGAAGTGGGAGG - Intergenic
1072989309 10:100175957-100175979 TGTAAACTTCCTGAAGTGTGTGG + Exonic
1079270772 11:18983679-18983701 TGTGGGCTTATGGATGTGGGAGG + Intergenic
1080157703 11:29131463-29131485 AGAAGCCTTATTGTAGTGGGTGG - Intergenic
1082137645 11:48567859-48567881 TGTAGAAATGTTGAAGGGGGTGG - Intergenic
1089056519 11:115590083-115590105 TCTAGACATTTTGAAGTGGGAGG - Intergenic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1092164923 12:6336744-6336766 TGGAGACTTGTTGAACTGGGAGG - Intronic
1095287886 12:40437768-40437790 TCTACACTTACTGAAGAGGGTGG - Intronic
1096884298 12:54701164-54701186 TGTGGACATCTTGGAGTGGGGGG - Intergenic
1101718021 12:107328097-107328119 TGTAGACTTGTGGCTGTGGGTGG - Intronic
1106180679 13:27366578-27366600 TGTAGAATTATTAAAGTTGTTGG + Intergenic
1108734722 13:53270734-53270756 TTTAGACTCATAGAAGGGGGGGG + Intergenic
1110101890 13:71616612-71616634 TGTAGTCTTATTTACTTGGGAGG + Intronic
1110993792 13:82077943-82077965 TGGAGACCTAATGAAGTAGGTGG - Intergenic
1112660095 13:101497931-101497953 TGTAGACGTATTAAACTGTGTGG - Intronic
1115119560 14:29924794-29924816 TGTGGAGTTAAGGAAGTGGGAGG - Intronic
1119925173 14:78486820-78486842 GGTAGACTTATAAAAGTAGGTGG + Intronic
1120254945 14:82106695-82106717 TGTGGACATTTTGAAGGGGGCGG + Intergenic
1120421424 14:84291155-84291177 TGTAAACTAATTGAATTGAGAGG + Intergenic
1120454128 14:84710059-84710081 TGTACAATTATTATAGTGGGAGG - Intergenic
1124238069 15:28006384-28006406 TGCAGACTGCTTGAAGTAGGTGG - Intronic
1126559409 15:50026949-50026971 TACAGGCTTATTGAAGAGGGAGG - Intronic
1127778355 15:62287780-62287802 TGAAGACTTCATGAAGTAGGTGG - Intergenic
1131803456 15:96096737-96096759 TGTTTACTTCTTAAAGTGGGTGG + Intergenic
1132396274 15:101477161-101477183 AGAAGACTTATTGACGTGGGAGG + Intronic
1134774236 16:16838014-16838036 TCCAGAGTTAGTGAAGTGGGAGG + Intergenic
1136546866 16:30959404-30959426 TGTCGACTTCTTGAAGGGTGAGG + Intronic
1137380687 16:47996401-47996423 TGTAGGATTATTGAAGTTGGAGG + Intergenic
1141059165 16:80849118-80849140 TGTAGACTTATTGTGGTGGTTGG - Intergenic
1144349968 17:14385496-14385518 TGGAGACTTACAGGAGTGGGAGG - Intergenic
1153704614 18:7733032-7733054 TGTAGACACATTGAAGGGTGAGG + Intronic
1155137736 18:23013200-23013222 TGCAGAGTTAGTCAAGTGGGAGG + Intronic
1155701076 18:28744604-28744626 TCTAGACTTATTGGAGTAGATGG + Intergenic
1157493553 18:48139756-48139778 AGCAGTCTTAGTGAAGTGGGTGG + Intronic
1158151498 18:54377640-54377662 TATAGACTTATTGGAGTAGTTGG + Intronic
930317910 2:49819910-49819932 TATAAACTTATTGAAGTCAGAGG - Intergenic
932921021 2:75915876-75915898 TGCAGACTTATTGAAGTACTTGG + Intergenic
936006873 2:108896948-108896970 TGCAGACATACTGGAGTGGGCGG - Exonic
936592469 2:113817339-113817361 TTTAGAATTAATGAAATGGGGGG + Intergenic
939417949 2:141924837-141924859 TGTAGTCCTATGGCAGTGGGTGG + Intronic
940432519 2:153610052-153610074 TGTTGACTGCTAGAAGTGGGAGG + Intergenic
941768317 2:169323500-169323522 TATAGACTAATTGAAGTAAGGGG - Intronic
942594658 2:177581381-177581403 TGTAGACTCATAGAAGAGAGAGG + Intergenic
943927125 2:193799504-193799526 TGTGGACACATTGAAGTGTGAGG + Intergenic
945612935 2:212028885-212028907 TCTAGAGTTAGTGAAGTAGGAGG + Intronic
947246422 2:228053676-228053698 TTTAGACTTAGTGAAGTAGCAGG - Intronic
1170556344 20:17518129-17518151 TGTAGATTTGTTGAAGGGAGTGG - Intronic
1177969422 21:27769931-27769953 TGTAGACTTAATAAAATGTGGGG + Intergenic
1177969469 21:27770491-27770513 TGTAGACCTGTAGATGTGGGAGG + Intergenic
1178195895 21:30344708-30344730 TGTTGTCTTATTGATATGGGAGG - Intergenic
1178826952 21:36025118-36025140 CAAAGACTTCTTGAAGTGGGAGG - Intergenic
1180153112 21:45962541-45962563 TGCAGACGTATTGAAGGGTGAGG + Intergenic
1182217852 22:28734229-28734251 CATAGATTTATTGAAGTGGAAGG - Intronic
1183255788 22:36761137-36761159 TGTTGAGGTGTTGAAGTGGGTGG - Intronic
949922767 3:9015868-9015890 TTTAAACTTGCTGAAGTGGGGGG - Intronic
950490441 3:13301437-13301459 TGCAGACTTCTGGAAGCGGGAGG - Intergenic
951932943 3:27990006-27990028 TATGGATTTATTGAAATGGGAGG - Intergenic
955137675 3:56235958-56235980 TATAAAATTATTTAAGTGGGAGG + Intronic
958266794 3:91447221-91447243 TGTAGACTTACTGAAGTGGGAGG + Intergenic
967358105 3:188596186-188596208 TGCAGAATTGTTGAAGGGGGAGG + Intronic
981427214 4:144617426-144617448 TGGAGACTAACAGAAGTGGGAGG + Intergenic
981781620 4:148437219-148437241 TGAGGACTTAGTGAAGTGGGTGG + Intronic
982866012 4:160512714-160512736 TGGAGACTACTTGAAGCGGGAGG + Intergenic
983353798 4:166629864-166629886 TGTAGAAATGTTGAACTGGGAGG + Intergenic
983791088 4:171797981-171798003 TGTTGACTACTAGAAGTGGGAGG - Intergenic
984121349 4:175749010-175749032 TGAAGGCTGATTGAGGTGGGGGG - Intronic
984487284 4:180387011-180387033 TGTACACTTTTTAAAGTGGGAGG + Intergenic
984824444 4:183912086-183912108 TTTAGAAATATTTAAGTGGGAGG - Intronic
985030899 4:185788205-185788227 CGTAGACTCATTGAAGTGTCAGG + Intronic
986608120 5:9543674-9543696 TGTATACTCATTGAAGTGTGGGG - Intronic
988679980 5:33475483-33475505 TCTAGATTTAATGAAGTAGGAGG - Intergenic
989458578 5:41669848-41669870 TGTAGTCTTAGTTAATTGGGGGG + Intergenic
993401368 5:87456848-87456870 TGAATACTTATTAAATTGGGGGG - Intergenic
993737176 5:91491581-91491603 GTTAGACTTCTTGAAGTTGGAGG - Intergenic
994097219 5:95858073-95858095 GGGACACTTGTTGAAGTGGGAGG - Intronic
995056066 5:107760232-107760254 TGTAAACTTATTGAAGGCAGGGG - Intergenic
996076830 5:119204800-119204822 TGTACAGTTTTTGAAGTTGGAGG + Intronic
1003172613 6:3732191-3732213 AATAGAGTTATTGAAGTGAGGGG - Intronic
1004368598 6:15033102-15033124 GGGAGACTGATTGAAGTGAGAGG - Intergenic
1005947975 6:30608897-30608919 TGCAGATTTATTGACGTTGGCGG - Exonic
1008192142 6:48473153-48473175 TGTGGACTGATTGACATGGGAGG - Intergenic
1008988417 6:57574374-57574396 TGTAGACTTATTGAAGTGGGAGG - Intronic
1009177028 6:60472963-60472985 TGTAGACTTACTGAAGTGGGAGG - Intergenic
1012386303 6:98687393-98687415 TGGAGACTAGTTGAGGTGGGAGG + Intergenic
1015691457 6:135928795-135928817 TGGGGACTGCTTGAAGTGGGAGG + Intronic
1015911521 6:138172292-138172314 AGGAGACTTATAGAAGTTGGGGG - Intronic
1016967012 6:149728634-149728656 TTTAGACTTATGGGAGGGGGAGG - Intronic
1021737211 7:23651464-23651486 TGTAGACTTATTGGACTCTGAGG + Intergenic
1024030784 7:45457907-45457929 TGCAGGCTTCTTGGAGTGGGTGG - Intergenic
1026285182 7:68956641-68956663 TGTAGACTTAATTCTGTGGGTGG - Intergenic
1026446863 7:70492243-70492265 TGTATACTTAATGAATTGGAGGG + Intronic
1027814636 7:82953246-82953268 TGAAGACTTGTTGGAGTGTGGGG + Exonic
1031182062 7:118431890-118431912 TGAAGAGATAATGAAGTGGGAGG - Intergenic
1040994133 8:53384560-53384582 TGTAGACGCATTGAAGGGTGAGG + Intergenic
1041868325 8:62602816-62602838 TATTGACTTATTGAAGTTAGTGG - Intronic
1043169825 8:76951821-76951843 TGGAGACTAATTGAAGGTGGAGG + Intergenic
1044219653 8:89654748-89654770 TGTAAACTCATTGATTTGGGAGG + Intergenic
1051565082 9:18488409-18488431 TCTATACTCATTGAAGTAGGAGG - Intronic
1055906164 9:81295451-81295473 TGTAGACTAACTGATGTGGAAGG + Intergenic
1186920697 X:14276254-14276276 TGATGACTTATTGAGATGGGTGG + Intergenic
1189218196 X:39345169-39345191 TGGAGAGATATTGAGGTGGGTGG - Intergenic
1191964196 X:66739118-66739140 TGGAGACTACTGGAAGTGGGAGG - Intergenic
1191974840 X:66860915-66860937 TGTTGTGTTATTGAAATGGGAGG + Intergenic
1192927621 X:75772261-75772283 TGTAGAGTTGTTGGGGTGGGTGG + Intergenic
1198399186 X:136252789-136252811 TGTAGATTAATACAAGTGGGGGG + Intronic
1198437900 X:136635229-136635251 TGTAGGCTTTTTGGGGTGGGAGG - Intergenic
1199403858 X:147432622-147432644 TGGAGACTACTTCAAGTGGGAGG + Intergenic
1199740988 X:150736136-150736158 TGTGGTCATATTGAATTGGGGGG + Intronic