ID: 1008999375

View in Genome Browser
Species Human (GRCh38)
Location 6:57695995-57696017
Sequence GACCTACACACTTTGGGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008999375_1008999379 -10 Left 1008999375 6:57695995-57696017 CCTGAACCCAAAGTGTGTAGGTC No data
Right 1008999379 6:57696008-57696030 TGTGTAGGTCAGTTTTAGGAAGG No data
1008999375_1008999380 -1 Left 1008999375 6:57695995-57696017 CCTGAACCCAAAGTGTGTAGGTC No data
Right 1008999380 6:57696017-57696039 CAGTTTTAGGAAGGTTCATATGG No data
1008999375_1008999381 8 Left 1008999375 6:57695995-57696017 CCTGAACCCAAAGTGTGTAGGTC No data
Right 1008999381 6:57696026-57696048 GAAGGTTCATATGGAATTTTAGG No data
1008999375_1008999382 14 Left 1008999375 6:57695995-57696017 CCTGAACCCAAAGTGTGTAGGTC No data
Right 1008999382 6:57696032-57696054 TCATATGGAATTTTAGGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008999375 Original CRISPR GACCTACACACTTTGGGTTC AGG (reversed) Intergenic
No off target data available for this crispr