ID: 1009006182

View in Genome Browser
Species Human (GRCh38)
Location 6:57791023-57791045
Sequence GCTCTTTGTGTTATACATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009006181_1009006182 -2 Left 1009006181 6:57791002-57791024 CCACAGTTTACATTACAGTTTGC No data
Right 1009006182 6:57791023-57791045 GCTCTTTGTGTTATACATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009006182 Original CRISPR GCTCTTTGTGTTATACATCC TGG Intergenic
No off target data available for this crispr