ID: 1009008187

View in Genome Browser
Species Human (GRCh38)
Location 6:57811989-57812011
Sequence GCTCTTTGTGTTATACATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009008186_1009008187 -2 Left 1009008186 6:57811968-57811990 CCACAGTTTACATTATAGTTTGC No data
Right 1009008187 6:57811989-57812011 GCTCTTTGTGTTATACATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009008187 Original CRISPR GCTCTTTGTGTTATACATCC TGG Intergenic
No off target data available for this crispr