ID: 1009011965

View in Genome Browser
Species Human (GRCh38)
Location 6:57853862-57853884
Sequence CACCAGCGCAAGTGGTTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009011965_1009011968 -3 Left 1009011965 6:57853862-57853884 CCAAGGAACCACTTGCGCTGGTG No data
Right 1009011968 6:57853882-57853904 GTGCGTCCGCGGCCGTCGCGAGG No data
1009011965_1009011971 16 Left 1009011965 6:57853862-57853884 CCAAGGAACCACTTGCGCTGGTG No data
Right 1009011971 6:57853901-57853923 GAGGCGTCCGTCCTTCCCCGAGG No data
1009011965_1009011975 27 Left 1009011965 6:57853862-57853884 CCAAGGAACCACTTGCGCTGGTG No data
Right 1009011975 6:57853912-57853934 CCTTCCCCGAGGGCGAGCGCCGG No data
1009011965_1009011972 17 Left 1009011965 6:57853862-57853884 CCAAGGAACCACTTGCGCTGGTG No data
Right 1009011972 6:57853902-57853924 AGGCGTCCGTCCTTCCCCGAGGG No data
1009011965_1009011976 28 Left 1009011965 6:57853862-57853884 CCAAGGAACCACTTGCGCTGGTG No data
Right 1009011976 6:57853913-57853935 CTTCCCCGAGGGCGAGCGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009011965 Original CRISPR CACCAGCGCAAGTGGTTCCT TGG (reversed) Intergenic