ID: 1009011966

View in Genome Browser
Species Human (GRCh38)
Location 6:57853870-57853892
Sequence CGCGGACGCACCAGCGCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009011966_1009011971 8 Left 1009011966 6:57853870-57853892 CCACTTGCGCTGGTGCGTCCGCG No data
Right 1009011971 6:57853901-57853923 GAGGCGTCCGTCCTTCCCCGAGG No data
1009011966_1009011975 19 Left 1009011966 6:57853870-57853892 CCACTTGCGCTGGTGCGTCCGCG No data
Right 1009011975 6:57853912-57853934 CCTTCCCCGAGGGCGAGCGCCGG No data
1009011966_1009011979 24 Left 1009011966 6:57853870-57853892 CCACTTGCGCTGGTGCGTCCGCG No data
Right 1009011979 6:57853917-57853939 CCCGAGGGCGAGCGCCGGGCAGG No data
1009011966_1009011981 28 Left 1009011966 6:57853870-57853892 CCACTTGCGCTGGTGCGTCCGCG No data
Right 1009011981 6:57853921-57853943 AGGGCGAGCGCCGGGCAGGCAGG No data
1009011966_1009011972 9 Left 1009011966 6:57853870-57853892 CCACTTGCGCTGGTGCGTCCGCG No data
Right 1009011972 6:57853902-57853924 AGGCGTCCGTCCTTCCCCGAGGG No data
1009011966_1009011976 20 Left 1009011966 6:57853870-57853892 CCACTTGCGCTGGTGCGTCCGCG No data
Right 1009011976 6:57853913-57853935 CTTCCCCGAGGGCGAGCGCCGGG No data
1009011966_1009011982 29 Left 1009011966 6:57853870-57853892 CCACTTGCGCTGGTGCGTCCGCG No data
Right 1009011982 6:57853922-57853944 GGGCGAGCGCCGGGCAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009011966 Original CRISPR CGCGGACGCACCAGCGCAAG TGG (reversed) Intergenic