ID: 1009011969

View in Genome Browser
Species Human (GRCh38)
Location 6:57853888-57853910
Sequence CGGACGCCTCGCGACGGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009011969_1009011975 1 Left 1009011969 6:57853888-57853910 CCGCGGCCGTCGCGAGGCGTCCG No data
Right 1009011975 6:57853912-57853934 CCTTCCCCGAGGGCGAGCGCCGG No data
1009011969_1009011982 11 Left 1009011969 6:57853888-57853910 CCGCGGCCGTCGCGAGGCGTCCG No data
Right 1009011982 6:57853922-57853944 GGGCGAGCGCCGGGCAGGCAGGG No data
1009011969_1009011976 2 Left 1009011969 6:57853888-57853910 CCGCGGCCGTCGCGAGGCGTCCG No data
Right 1009011976 6:57853913-57853935 CTTCCCCGAGGGCGAGCGCCGGG No data
1009011969_1009011971 -10 Left 1009011969 6:57853888-57853910 CCGCGGCCGTCGCGAGGCGTCCG No data
Right 1009011971 6:57853901-57853923 GAGGCGTCCGTCCTTCCCCGAGG No data
1009011969_1009011981 10 Left 1009011969 6:57853888-57853910 CCGCGGCCGTCGCGAGGCGTCCG No data
Right 1009011981 6:57853921-57853943 AGGGCGAGCGCCGGGCAGGCAGG No data
1009011969_1009011979 6 Left 1009011969 6:57853888-57853910 CCGCGGCCGTCGCGAGGCGTCCG No data
Right 1009011979 6:57853917-57853939 CCCGAGGGCGAGCGCCGGGCAGG No data
1009011969_1009011972 -9 Left 1009011969 6:57853888-57853910 CCGCGGCCGTCGCGAGGCGTCCG No data
Right 1009011972 6:57853902-57853924 AGGCGTCCGTCCTTCCCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009011969 Original CRISPR CGGACGCCTCGCGACGGCCG CGG (reversed) Intergenic
No off target data available for this crispr