ID: 1009011970

View in Genome Browser
Species Human (GRCh38)
Location 6:57853894-57853916
Sequence GAAGGACGGACGCCTCGCGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009011970_1009011981 4 Left 1009011970 6:57853894-57853916 CCGTCGCGAGGCGTCCGTCCTTC No data
Right 1009011981 6:57853921-57853943 AGGGCGAGCGCCGGGCAGGCAGG No data
1009011970_1009011979 0 Left 1009011970 6:57853894-57853916 CCGTCGCGAGGCGTCCGTCCTTC No data
Right 1009011979 6:57853917-57853939 CCCGAGGGCGAGCGCCGGGCAGG No data
1009011970_1009011975 -5 Left 1009011970 6:57853894-57853916 CCGTCGCGAGGCGTCCGTCCTTC No data
Right 1009011975 6:57853912-57853934 CCTTCCCCGAGGGCGAGCGCCGG No data
1009011970_1009011982 5 Left 1009011970 6:57853894-57853916 CCGTCGCGAGGCGTCCGTCCTTC No data
Right 1009011982 6:57853922-57853944 GGGCGAGCGCCGGGCAGGCAGGG No data
1009011970_1009011984 26 Left 1009011970 6:57853894-57853916 CCGTCGCGAGGCGTCCGTCCTTC No data
Right 1009011984 6:57853943-57853965 GGACTCGCCACCCGCAGCCCTGG No data
1009011970_1009011976 -4 Left 1009011970 6:57853894-57853916 CCGTCGCGAGGCGTCCGTCCTTC No data
Right 1009011976 6:57853913-57853935 CTTCCCCGAGGGCGAGCGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009011970 Original CRISPR GAAGGACGGACGCCTCGCGA CGG (reversed) Intergenic