ID: 1009011973

View in Genome Browser
Species Human (GRCh38)
Location 6:57853908-57853930
Sequence CGCTCGCCCTCGGGGAAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009011973_1009011981 -10 Left 1009011973 6:57853908-57853930 CCGTCCTTCCCCGAGGGCGAGCG No data
Right 1009011981 6:57853921-57853943 AGGGCGAGCGCCGGGCAGGCAGG No data
1009011973_1009011984 12 Left 1009011973 6:57853908-57853930 CCGTCCTTCCCCGAGGGCGAGCG No data
Right 1009011984 6:57853943-57853965 GGACTCGCCACCCGCAGCCCTGG No data
1009011973_1009011987 19 Left 1009011973 6:57853908-57853930 CCGTCCTTCCCCGAGGGCGAGCG No data
Right 1009011987 6:57853950-57853972 CCACCCGCAGCCCTGGAGCCGGG No data
1009011973_1009011985 18 Left 1009011973 6:57853908-57853930 CCGTCCTTCCCCGAGGGCGAGCG No data
Right 1009011985 6:57853949-57853971 GCCACCCGCAGCCCTGGAGCCGG No data
1009011973_1009011982 -9 Left 1009011973 6:57853908-57853930 CCGTCCTTCCCCGAGGGCGAGCG No data
Right 1009011982 6:57853922-57853944 GGGCGAGCGCCGGGCAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009011973 Original CRISPR CGCTCGCCCTCGGGGAAGGA CGG (reversed) Intergenic