ID: 1009011976

View in Genome Browser
Species Human (GRCh38)
Location 6:57853913-57853935
Sequence CTTCCCCGAGGGCGAGCGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009011969_1009011976 2 Left 1009011969 6:57853888-57853910 CCGCGGCCGTCGCGAGGCGTCCG No data
Right 1009011976 6:57853913-57853935 CTTCCCCGAGGGCGAGCGCCGGG No data
1009011965_1009011976 28 Left 1009011965 6:57853862-57853884 CCAAGGAACCACTTGCGCTGGTG No data
Right 1009011976 6:57853913-57853935 CTTCCCCGAGGGCGAGCGCCGGG No data
1009011966_1009011976 20 Left 1009011966 6:57853870-57853892 CCACTTGCGCTGGTGCGTCCGCG No data
Right 1009011976 6:57853913-57853935 CTTCCCCGAGGGCGAGCGCCGGG No data
1009011970_1009011976 -4 Left 1009011970 6:57853894-57853916 CCGTCGCGAGGCGTCCGTCCTTC No data
Right 1009011976 6:57853913-57853935 CTTCCCCGAGGGCGAGCGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009011976 Original CRISPR CTTCCCCGAGGGCGAGCGCC GGG Intergenic