ID: 1009020042

View in Genome Browser
Species Human (GRCh38)
Location 6:57938966-57938988
Sequence GCTGAGGCCCAGAAATGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009020042_1009020043 -8 Left 1009020042 6:57938966-57938988 CCTTCACATTTCTGGGCCTCAGC No data
Right 1009020043 6:57938981-57939003 GCCTCAGCCACAGCTGCAGCAGG No data
1009020042_1009020046 2 Left 1009020042 6:57938966-57938988 CCTTCACATTTCTGGGCCTCAGC No data
Right 1009020046 6:57938991-57939013 CAGCTGCAGCAGGTGCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009020042 Original CRISPR GCTGAGGCCCAGAAATGTGA AGG (reversed) Intergenic
No off target data available for this crispr