ID: 1009020043

View in Genome Browser
Species Human (GRCh38)
Location 6:57938981-57939003
Sequence GCCTCAGCCACAGCTGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009020041_1009020043 -7 Left 1009020041 6:57938965-57938987 CCCTTCACATTTCTGGGCCTCAG No data
Right 1009020043 6:57938981-57939003 GCCTCAGCCACAGCTGCAGCAGG No data
1009020035_1009020043 30 Left 1009020035 6:57938928-57938950 CCACGTCGGGGTCACTACTCAAT No data
Right 1009020043 6:57938981-57939003 GCCTCAGCCACAGCTGCAGCAGG No data
1009020042_1009020043 -8 Left 1009020042 6:57938966-57938988 CCTTCACATTTCTGGGCCTCAGC No data
Right 1009020043 6:57938981-57939003 GCCTCAGCCACAGCTGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009020043 Original CRISPR GCCTCAGCCACAGCTGCAGC AGG Intergenic
No off target data available for this crispr