ID: 1009023222

View in Genome Browser
Species Human (GRCh38)
Location 6:57967873-57967895
Sequence AGGGCCCCTCAAGAACATCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 69}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009023222_1009023226 4 Left 1009023222 6:57967873-57967895 CCACGATGTTCTTGAGGGGCCCT 0: 1
1: 1
2: 0
3: 8
4: 69
Right 1009023226 6:57967900-57967922 TGCCTCCTTCATTACCTTCTTGG No data
1009023222_1009023231 23 Left 1009023222 6:57967873-57967895 CCACGATGTTCTTGAGGGGCCCT 0: 1
1: 1
2: 0
3: 8
4: 69
Right 1009023231 6:57967919-57967941 TTGGTGTTACCATATTTGGCAGG No data
1009023222_1009023230 19 Left 1009023222 6:57967873-57967895 CCACGATGTTCTTGAGGGGCCCT 0: 1
1: 1
2: 0
3: 8
4: 69
Right 1009023230 6:57967915-57967937 CTTCTTGGTGTTACCATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009023222 Original CRISPR AGGGCCCCTCAAGAACATCG TGG (reversed) Intergenic