ID: 1009023231

View in Genome Browser
Species Human (GRCh38)
Location 6:57967919-57967941
Sequence TTGGTGTTACCATATTTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009023221_1009023231 24 Left 1009023221 6:57967872-57967894 CCCACGATGTTCTTGAGGGGCCC 0: 1
1: 0
2: 0
3: 6
4: 51
Right 1009023231 6:57967919-57967941 TTGGTGTTACCATATTTGGCAGG No data
1009023222_1009023231 23 Left 1009023222 6:57967873-57967895 CCACGATGTTCTTGAGGGGCCCT 0: 1
1: 1
2: 0
3: 8
4: 69
Right 1009023231 6:57967919-57967941 TTGGTGTTACCATATTTGGCAGG No data
1009023223_1009023231 4 Left 1009023223 6:57967892-57967914 CCCTTCCGTGCCTCCTTCATTAC No data
Right 1009023231 6:57967919-57967941 TTGGTGTTACCATATTTGGCAGG No data
1009023227_1009023231 -6 Left 1009023227 6:57967902-57967924 CCTCCTTCATTACCTTCTTGGTG No data
Right 1009023231 6:57967919-57967941 TTGGTGTTACCATATTTGGCAGG No data
1009023224_1009023231 3 Left 1009023224 6:57967893-57967915 CCTTCCGTGCCTCCTTCATTACC No data
Right 1009023231 6:57967919-57967941 TTGGTGTTACCATATTTGGCAGG No data
1009023228_1009023231 -9 Left 1009023228 6:57967905-57967927 CCTTCATTACCTTCTTGGTGTTA No data
Right 1009023231 6:57967919-57967941 TTGGTGTTACCATATTTGGCAGG No data
1009023225_1009023231 -1 Left 1009023225 6:57967897-57967919 CCGTGCCTCCTTCATTACCTTCT No data
Right 1009023231 6:57967919-57967941 TTGGTGTTACCATATTTGGCAGG No data
1009023220_1009023231 25 Left 1009023220 6:57967871-57967893 CCCCACGATGTTCTTGAGGGGCC 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1009023231 6:57967919-57967941 TTGGTGTTACCATATTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009023231 Original CRISPR TTGGTGTTACCATATTTGGC AGG Intergenic