ID: 1009031237

View in Genome Browser
Species Human (GRCh38)
Location 6:58060793-58060815
Sequence GGGTGAACAGAGTGTGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009031237_1009031244 27 Left 1009031237 6:58060793-58060815 CCCATCTCACACTCTGTTCACCC No data
Right 1009031244 6:58060843-58060865 TTTCTTATATGTTCTTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009031237 Original CRISPR GGGTGAACAGAGTGTGAGAT GGG (reversed) Intergenic
No off target data available for this crispr