ID: 1009046844

View in Genome Browser
Species Human (GRCh38)
Location 6:58244368-58244390
Sequence GTGGACACCCTCTGCGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009046844_1009046849 9 Left 1009046844 6:58244368-58244390 CCAATATCGCAGAGGGTGTCCAC No data
Right 1009046849 6:58244400-58244422 ACACTGTTTGTAATATCCAAAGG No data
1009046844_1009046853 17 Left 1009046844 6:58244368-58244390 CCAATATCGCAGAGGGTGTCCAC No data
Right 1009046853 6:58244408-58244430 TGTAATATCCAAAGGGGGAGAGG No data
1009046844_1009046850 10 Left 1009046844 6:58244368-58244390 CCAATATCGCAGAGGGTGTCCAC No data
Right 1009046850 6:58244401-58244423 CACTGTTTGTAATATCCAAAGGG No data
1009046844_1009046851 11 Left 1009046844 6:58244368-58244390 CCAATATCGCAGAGGGTGTCCAC No data
Right 1009046851 6:58244402-58244424 ACTGTTTGTAATATCCAAAGGGG No data
1009046844_1009046852 12 Left 1009046844 6:58244368-58244390 CCAATATCGCAGAGGGTGTCCAC No data
Right 1009046852 6:58244403-58244425 CTGTTTGTAATATCCAAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009046844 Original CRISPR GTGGACACCCTCTGCGATAT TGG (reversed) Intergenic
No off target data available for this crispr