ID: 1009046849

View in Genome Browser
Species Human (GRCh38)
Location 6:58244400-58244422
Sequence ACACTGTTTGTAATATCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009046844_1009046849 9 Left 1009046844 6:58244368-58244390 CCAATATCGCAGAGGGTGTCCAC No data
Right 1009046849 6:58244400-58244422 ACACTGTTTGTAATATCCAAAGG No data
1009046845_1009046849 -10 Left 1009046845 6:58244387-58244409 CCACCCCACTGTGACACTGTTTG No data
Right 1009046849 6:58244400-58244422 ACACTGTTTGTAATATCCAAAGG No data
1009046843_1009046849 10 Left 1009046843 6:58244367-58244389 CCCAATATCGCAGAGGGTGTCCA No data
Right 1009046849 6:58244400-58244422 ACACTGTTTGTAATATCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009046849 Original CRISPR ACACTGTTTGTAATATCCAA AGG Intergenic
No off target data available for this crispr