ID: 1009046851

View in Genome Browser
Species Human (GRCh38)
Location 6:58244402-58244424
Sequence ACTGTTTGTAATATCCAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009046844_1009046851 11 Left 1009046844 6:58244368-58244390 CCAATATCGCAGAGGGTGTCCAC No data
Right 1009046851 6:58244402-58244424 ACTGTTTGTAATATCCAAAGGGG No data
1009046845_1009046851 -8 Left 1009046845 6:58244387-58244409 CCACCCCACTGTGACACTGTTTG No data
Right 1009046851 6:58244402-58244424 ACTGTTTGTAATATCCAAAGGGG No data
1009046843_1009046851 12 Left 1009046843 6:58244367-58244389 CCCAATATCGCAGAGGGTGTCCA No data
Right 1009046851 6:58244402-58244424 ACTGTTTGTAATATCCAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009046851 Original CRISPR ACTGTTTGTAATATCCAAAG GGG Intergenic
No off target data available for this crispr