ID: 1009046852

View in Genome Browser
Species Human (GRCh38)
Location 6:58244403-58244425
Sequence CTGTTTGTAATATCCAAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009046843_1009046852 13 Left 1009046843 6:58244367-58244389 CCCAATATCGCAGAGGGTGTCCA No data
Right 1009046852 6:58244403-58244425 CTGTTTGTAATATCCAAAGGGGG No data
1009046844_1009046852 12 Left 1009046844 6:58244368-58244390 CCAATATCGCAGAGGGTGTCCAC No data
Right 1009046852 6:58244403-58244425 CTGTTTGTAATATCCAAAGGGGG No data
1009046846_1009046852 -10 Left 1009046846 6:58244390-58244412 CCCCACTGTGACACTGTTTGTAA No data
Right 1009046852 6:58244403-58244425 CTGTTTGTAATATCCAAAGGGGG No data
1009046845_1009046852 -7 Left 1009046845 6:58244387-58244409 CCACCCCACTGTGACACTGTTTG No data
Right 1009046852 6:58244403-58244425 CTGTTTGTAATATCCAAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009046852 Original CRISPR CTGTTTGTAATATCCAAAGG GGG Intergenic
No off target data available for this crispr