ID: 1009046853

View in Genome Browser
Species Human (GRCh38)
Location 6:58244408-58244430
Sequence TGTAATATCCAAAGGGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009046845_1009046853 -2 Left 1009046845 6:58244387-58244409 CCACCCCACTGTGACACTGTTTG No data
Right 1009046853 6:58244408-58244430 TGTAATATCCAAAGGGGGAGAGG No data
1009046848_1009046853 -7 Left 1009046848 6:58244392-58244414 CCACTGTGACACTGTTTGTAATA No data
Right 1009046853 6:58244408-58244430 TGTAATATCCAAAGGGGGAGAGG No data
1009046846_1009046853 -5 Left 1009046846 6:58244390-58244412 CCCCACTGTGACACTGTTTGTAA No data
Right 1009046853 6:58244408-58244430 TGTAATATCCAAAGGGGGAGAGG No data
1009046844_1009046853 17 Left 1009046844 6:58244368-58244390 CCAATATCGCAGAGGGTGTCCAC No data
Right 1009046853 6:58244408-58244430 TGTAATATCCAAAGGGGGAGAGG No data
1009046847_1009046853 -6 Left 1009046847 6:58244391-58244413 CCCACTGTGACACTGTTTGTAAT No data
Right 1009046853 6:58244408-58244430 TGTAATATCCAAAGGGGGAGAGG No data
1009046843_1009046853 18 Left 1009046843 6:58244367-58244389 CCCAATATCGCAGAGGGTGTCCA No data
Right 1009046853 6:58244408-58244430 TGTAATATCCAAAGGGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009046853 Original CRISPR TGTAATATCCAAAGGGGGAG AGG Intergenic
No off target data available for this crispr