ID: 1009048866

View in Genome Browser
Species Human (GRCh38)
Location 6:58256777-58256799
Sequence TATAGGGAACAATATTACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009048857_1009048866 17 Left 1009048857 6:58256737-58256759 CCAGTGATATTGGTGGTAATATT No data
Right 1009048866 6:58256777-58256799 TATAGGGAACAATATTACATAGG No data
1009048856_1009048866 20 Left 1009048856 6:58256734-58256756 CCACCAGTGATATTGGTGGTAAT No data
Right 1009048866 6:58256777-58256799 TATAGGGAACAATATTACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009048866 Original CRISPR TATAGGGAACAATATTACAT AGG Intergenic
No off target data available for this crispr