ID: 1009049919

View in Genome Browser
Species Human (GRCh38)
Location 6:58263515-58263537
Sequence CCTAATATTTAGAAGGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009049919_1009049924 -5 Left 1009049919 6:58263515-58263537 CCACTCTCCTTCTAAATATTAGG No data
Right 1009049924 6:58263533-58263555 TTAGGAACAATATCACAGGGAGG No data
1009049919_1009049927 19 Left 1009049919 6:58263515-58263537 CCACTCTCCTTCTAAATATTAGG No data
Right 1009049927 6:58263557-58263579 TGTACACCCCCTGTGATAATGGG No data
1009049919_1009049925 -4 Left 1009049919 6:58263515-58263537 CCACTCTCCTTCTAAATATTAGG No data
Right 1009049925 6:58263534-58263556 TAGGAACAATATCACAGGGAGGG No data
1009049919_1009049922 -9 Left 1009049919 6:58263515-58263537 CCACTCTCCTTCTAAATATTAGG No data
Right 1009049922 6:58263529-58263551 AATATTAGGAACAATATCACAGG No data
1009049919_1009049923 -8 Left 1009049919 6:58263515-58263537 CCACTCTCCTTCTAAATATTAGG No data
Right 1009049923 6:58263530-58263552 ATATTAGGAACAATATCACAGGG No data
1009049919_1009049926 18 Left 1009049919 6:58263515-58263537 CCACTCTCCTTCTAAATATTAGG No data
Right 1009049926 6:58263556-58263578 GTGTACACCCCCTGTGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009049919 Original CRISPR CCTAATATTTAGAAGGAGAG TGG (reversed) Intergenic
No off target data available for this crispr