ID: 1009058537

View in Genome Browser
Species Human (GRCh38)
Location 6:58369019-58369041
Sequence CTTGTAAGTCAGATCTGATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009058537_1009058540 -10 Left 1009058537 6:58369019-58369041 CCCTATCAGATCTGACTTACAAG No data
Right 1009058540 6:58369032-58369054 GACTTACAAGAAATGCTAAAGGG 0: 5
1: 103
2: 572
3: 1158
4: 1852

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009058537 Original CRISPR CTTGTAAGTCAGATCTGATA GGG (reversed) Intergenic
No off target data available for this crispr