ID: 1009058537 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:58369019-58369041 |
| Sequence | CTTGTAAGTCAGATCTGATA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1009058537_1009058540 | -10 | Left | 1009058537 | 6:58369019-58369041 | CCCTATCAGATCTGACTTACAAG | No data | ||
| Right | 1009058540 | 6:58369032-58369054 | GACTTACAAGAAATGCTAAAGGG | 0: 5 1: 103 2: 572 3: 1158 4: 1852 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1009058537 | Original CRISPR | CTTGTAAGTCAGATCTGATA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||