ID: 1009059832

View in Genome Browser
Species Human (GRCh38)
Location 6:58385552-58385574
Sequence TTCATTCCACTTCAACCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009059832_1009059834 -4 Left 1009059832 6:58385552-58385574 CCATGTGGTTGAAGTGGAATGAA No data
Right 1009059834 6:58385571-58385593 TGAATGAGTTTGAGAGGTGTAGG No data
1009059832_1009059835 22 Left 1009059832 6:58385552-58385574 CCATGTGGTTGAAGTGGAATGAA No data
Right 1009059835 6:58385597-58385619 TGACATCAGAAAAATAATTAAGG No data
1009059832_1009059836 23 Left 1009059832 6:58385552-58385574 CCATGTGGTTGAAGTGGAATGAA No data
Right 1009059836 6:58385598-58385620 GACATCAGAAAAATAATTAAGGG No data
1009059832_1009059833 -10 Left 1009059832 6:58385552-58385574 CCATGTGGTTGAAGTGGAATGAA No data
Right 1009059833 6:58385565-58385587 GTGGAATGAATGAGTTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009059832 Original CRISPR TTCATTCCACTTCAACCACA TGG (reversed) Intergenic
No off target data available for this crispr