ID: 1009059833

View in Genome Browser
Species Human (GRCh38)
Location 6:58385565-58385587
Sequence GTGGAATGAATGAGTTTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009059831_1009059833 -9 Left 1009059831 6:58385551-58385573 CCCATGTGGTTGAAGTGGAATGA No data
Right 1009059833 6:58385565-58385587 GTGGAATGAATGAGTTTGAGAGG No data
1009059832_1009059833 -10 Left 1009059832 6:58385552-58385574 CCATGTGGTTGAAGTGGAATGAA No data
Right 1009059833 6:58385565-58385587 GTGGAATGAATGAGTTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009059833 Original CRISPR GTGGAATGAATGAGTTTGAG AGG Intergenic
No off target data available for this crispr