ID: 1009059947

View in Genome Browser
Species Human (GRCh38)
Location 6:58386998-58387020
Sequence AGACTGTGGCTCTCACAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009059944_1009059947 15 Left 1009059944 6:58386960-58386982 CCTAGATGCGGCCAAGATGGCTG No data
Right 1009059947 6:58386998-58387020 AGACTGTGGCTCTCACAGAGAGG No data
1009059942_1009059947 24 Left 1009059942 6:58386951-58386973 CCATTGGTGCCTAGATGCGGCCA 0: 1
1: 1
2: 0
3: 1
4: 50
Right 1009059947 6:58386998-58387020 AGACTGTGGCTCTCACAGAGAGG No data
1009059945_1009059947 4 Left 1009059945 6:58386971-58386993 CCAAGATGGCTGATTAGAAGTAG No data
Right 1009059947 6:58386998-58387020 AGACTGTGGCTCTCACAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009059947 Original CRISPR AGACTGTGGCTCTCACAGAG AGG Intergenic
No off target data available for this crispr