ID: 1009063849

View in Genome Browser
Species Human (GRCh38)
Location 6:58432313-58432335
Sequence CAGGATAAAAAGTAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009063849_1009063859 26 Left 1009063849 6:58432313-58432335 CCTTCCTTCTACTTTTTATCCTG No data
Right 1009063859 6:58432362-58432384 CCAAATGTCCATTTGCATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009063849 Original CRISPR CAGGATAAAAAGTAGAAGGA AGG (reversed) Intergenic
No off target data available for this crispr