ID: 1009157663

View in Genome Browser
Species Human (GRCh38)
Location 6:60243023-60243045
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009157661_1009157663 4 Left 1009157661 6:60242996-60243018 CCTTCTTGTGTGACTGTTTCAGT No data
Right 1009157663 6:60243023-60243045 CTAGTTCAGTGATTCTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009157663 Original CRISPR CTAGTTCAGTGATTCTCAGT GGG Intergenic
No off target data available for this crispr