ID: 1009158558

View in Genome Browser
Species Human (GRCh38)
Location 6:60253331-60253353
Sequence CTGTGAGAATGGAAAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009158555_1009158558 18 Left 1009158555 6:60253290-60253312 CCAAATGAAAGACTGAATGAGGA No data
Right 1009158558 6:60253331-60253353 CTGTGAGAATGGAAAGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009158558 Original CRISPR CTGTGAGAATGGAAAGAAGT GGG Intergenic
No off target data available for this crispr